Rh5CG539700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
75418760 .. 75419182
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG539700.1

Sequence Viewer

Length: 423 bp
ATGCCGAACTTGGATATTTATTCCTTTAATCCCACTCTCCCAAACCGTCCATTGATCACCATGTGCAACGGTGTCATTCCCATGTTGATTGATCCAAAAGCTAAGACCATTCCTATCGTGACCACTATTGAGGAGAAAATTTATGTTCTCACCAAAAGACCATATTCAGAAGAACTTGATGATGATCAGCGCCCCAAATTTAAGGTTTTTGATCCCTCCACCAATCTTGGAAACATCTTCCTGATCCCCCTTGTTATAATAAATCATTACATGACACAGAACTTTTTGTGCATAACCACTTTGCTTGGGGGCACAAGCTTATTATTAGCACCAAGTTGGGTTCGTACATTTTTGATACTCATCAAGAGAAATGGGAGGATACCCGCCACGAATTCCCGAATGAGGGGTTTAAGGCTGTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

15.97

Weight (kDa)

9.64

Isoelectric Point (pI)

40.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 257
AciI CCGC 1 cut(s) 384
AclWI GGATC 3 cut(s) 86, 206, 238
AcsI RAATTY 3 cut(s) 138, 197, 391
AdeI CACNNNGTG 1 cut(s) 63
AfaI GTAC 1 cut(s) 346
AfiI CCNNNNNNNGG 2 cut(s) 402, 403
AluBI AGCT 2 cut(s) 101, 318
AluI AGCT 2 cut(s) 101, 318
AlwI GGATC 3 cut(s) 86, 206, 238
ApoI RAATTY 3 cut(s) 138, 197, 391
AspLEI GCGC 1 cut(s) 192
AsuHPI GGTGA 2 cut(s) 49, 142
BaeGI GKGCMC 1 cut(s) 314
BciVI GTATCC 1 cut(s) 372
BclI TGATCA 2 cut(s) 54, 184
BfoI RGCGCY 1 cut(s) 193
BfuI GTATCC 1 cut(s) 372
BsaBI GATNNNNATC 2 cut(s) 183, 359
Bsc4I CCNNNNNNNGG 2 cut(s) 402, 403
Bse8I GATNNNNATC 2 cut(s) 183, 359
BseJI GATNNNNATC 2 cut(s) 183, 359
BseLI CCNNNNNNNGG 2 cut(s) 402, 403
BseRI GAGGAG 1 cut(s) 146
BseSI GKGCMC 1 cut(s) 314
BslI CCNNNNNNNGG 2 cut(s) 402, 403
Bsp1286I GDGCHC 1 cut(s) 314
Bsp143I GATC 5 cut(s) 54, 91, 184, 211, 243
BspACI CCGC 1 cut(s) 384
BspPI GGATC 3 cut(s) 86, 206, 238
BssMI GATC 5 cut(s) 54, 91, 184, 211, 243
Bst4CI ACNGT 2 cut(s) 47, 71
BstDEI CTNAG 1 cut(s) 102
BstH2I RGCGCY 1 cut(s) 193
BstHHI GCGC 1 cut(s) 192
BstKTI GATC 5 cut(s) 57, 94, 187, 214, 246
BstMBI GATC 5 cut(s) 54, 91, 184, 211, 243
BstSLI GKGCMC 1 cut(s) 314
BsuI GTATCC 1 cut(s) 372
CfoI GCGC 1 cut(s) 192
Csp6I GTAC 1 cut(s) 345
CspCI CAANNNNNGTGG 4 cut(s) 208, 243, 286, 321
CviAII CATG 3 cut(s) 61, 82, 271
CviJI RGCY 3 cut(s) 101, 318, 415
CviKI_1 RGCY 3 cut(s) 101, 318, 415
CviQI GTAC 1 cut(s) 345
DdeI CTNAG 1 cut(s) 102
DpnI GATC 5 cut(s) 56, 93, 186, 213, 245
DpnII GATC 5 cut(s) 54, 91, 184, 211, 243
DraIII CACNNNGTG 1 cut(s) 63
EcoRI GAATTC 1 cut(s) 391
FaeI CATG 3 cut(s) 64, 85, 274
FaiI YATR 7 cut(s) 62, 83, 144, 163, 257, 272, 293
FatI CATG 3 cut(s) 60, 81, 270
FauI CCCGC 1 cut(s) 391
FbaI TGATCA 2 cut(s) 54, 184
GlaI GCGC 1 cut(s) 191
HaeII RGCGCY 1 cut(s) 193
HhaI GCGC 1 cut(s) 192
Hin1II CATG 3 cut(s) 64, 85, 274
Hin6I GCGC 1 cut(s) 190
HinP1I GCGC 1 cut(s) 190
HindIII AAGCTT 1 cut(s) 316
HphI GGTGA 2 cut(s) 49, 142
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 4 cut(s) 118, 241, 364, 396
HpyCH4III ACNGT 2 cut(s) 47, 71
HpyCH4V TGCA 2 cut(s) 66, 291
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 3 cut(s) 64, 85, 274
HspAI GCGC 1 cut(s) 190
Ksp22I TGATCA 2 cut(s) 54, 184
Kzo9I GATC 5 cut(s) 54, 91, 184, 211, 243
LpnPI CCDG 1 cut(s) 254
MaeIII GTNAC 1 cut(s) 118
MalI GATC 5 cut(s) 56, 93, 186, 213, 245
MboI GATC 5 cut(s) 54, 91, 184, 211, 243
MboII GAAGA 2 cut(s) 182, 229
MhlI GDGCHC 1 cut(s) 314
MluCI AATT 3 cut(s) 138, 197, 391
MnlI CCTC 4 cut(s) 124, 226, 369, 396
MseI TTAA 3 cut(s) 27, 201, 410
MslI CAYNNNNRTG 1 cut(s) 80
NdeII GATC 5 cut(s) 54, 91, 184, 211, 243
NlaIII CATG 3 cut(s) 64, 85, 274
NmuCI GTSAC 1 cut(s) 118
PsiI TTATAA 1 cut(s) 257
RsaI GTAC 1 cut(s) 346
RsaNI GTAC 1 cut(s) 345
RseI CAYNNNNRTG 1 cut(s) 80
SaqAI TTAA 3 cut(s) 27, 201, 410
Sau3AI GATC 5 cut(s) 54, 91, 184, 211, 243
SduI GDGCHC 1 cut(s) 314
SetI ASST 3 cut(s) 103, 207, 320
SmiMI CAYNNNNRTG 1 cut(s) 80
Sse9I AATT 3 cut(s) 138, 197, 391
SsiI CCGC 1 cut(s) 384
TaaI ACNGT 2 cut(s) 47, 71
TasI AATT 3 cut(s) 138, 197, 391
Tru1I TTAA 3 cut(s) 27, 201, 410
Tru9I TTAA 3 cut(s) 27, 201, 410
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
XapI RAATTY 3 cut(s) 138, 197, 391
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.