Rh2AG553000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
78373409 .. 78382476
9068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG553000.1

Sequence Viewer

Length: 201 bp
ATGAATAAGGTCGTTGCTTATAAGTTGGATTCAAATGGAATCCCCAACCCTGAGTCGTATCAAGTGCTACGTGAGATATCTTCTACAGGAGAGATGGCTTTCTTGGGTAAATGTGATGGTGGCCGACTGTGGTTGGTGTATTGTATCAAGGATGACTCTTATAACCGCTTAACAGGTGGGAAGAAGGGGGCGGCTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.25

Weight (kDa)

7.74

Isoelectric Point (pI)

26.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 21, 162
AciI CCGC 2 cut(s) 166, 191
AcoI YGGCCR 1 cut(s) 121
AgsI TTSAA 1 cut(s) 33
AoxI GGCC 1 cut(s) 121
BccI CCATC 2 cut(s) 88, 110
BfmI CTRYAG 1 cut(s) 84
BisI GCNGC 1 cut(s) 192
BlsI GCNGC 1 cut(s) 193
BsaAI YACGTR 1 cut(s) 71
BseGI GGATG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 42
BshFI GGCC 1 cut(s) 123
BsnI GGCC 1 cut(s) 123
BspACI CCGC 2 cut(s) 166, 191
BspANI GGCC 1 cut(s) 123
BspCNI CTCAG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 129
BstBAI YACGTR 1 cut(s) 71
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 1 cut(s) 157
BstSFI CTRYAG 1 cut(s) 84
BsuRI GGCC 1 cut(s) 123
BtsCI GGATG 1 cut(s) 157
CviJI RGCY 3 cut(s) 98, 123, 194
CviKI_1 RGCY 3 cut(s) 98, 123, 194
DdeI CTNAG 1 cut(s) 51
EaeI YGGCCR 1 cut(s) 121
Eco32I GATATC 1 cut(s) 78
EcoRV GATATC 1 cut(s) 78
FaiI YATR 2 cut(s) 21, 162
Fnu4HI GCNGC 1 cut(s) 192
FokI GGATG 1 cut(s) 164
Fsp4HI GCNGC 1 cut(s) 192
GluI GCNGC 1 cut(s) 192
HaeIII GGCC 1 cut(s) 123
HinfI GANTC 4 cut(s) 29, 39, 53, 155
HpyAV CCTTC 1 cut(s) 178
HpyCH4III ACNGT 1 cut(s) 129
HpyCH4IV ACGT 1 cut(s) 70
HpyF3I CTNAG 1 cut(s) 51
HpySE526I ACGT 1 cut(s) 70
LpnPI CCDG 3 cut(s) 63, 72, 159
MaeII ACGT 1 cut(s) 70
MboII GAAGA 2 cut(s) 72, 193
MlyI GAGTC 2 cut(s) 62, 149
MmeI TCCRAC 1 cut(s) 6
MseI TTAA 1 cut(s) 170
PfeI GAWTC 2 cut(s) 29, 39
PkrI GCNGC 1 cut(s) 193
PleI GAGTC 2 cut(s) 61, 149
PpsI GAGTC 2 cut(s) 61, 149
Ppu21I YACGTR 1 cut(s) 71
PsiI TTATAA 2 cut(s) 21, 162
SaqAI TTAA 1 cut(s) 170
SatI GCNGC 1 cut(s) 192
SchI GAGTC 2 cut(s) 62, 149
SetI ASST 3 cut(s) 12, 73, 178
SfcI CTRYAG 1 cut(s) 84
SgeI CNNG 7 cut(s) 62, 74, 83, 99, 115, 160, 186
SsiI CCGC 2 cut(s) 166, 191
TaaI ACNGT 1 cut(s) 129
TaiI ACGT 1 cut(s) 73
TauI GCSGC 1 cut(s) 194
TfiI GAWTC 2 cut(s) 29, 39
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.