RchiOBHm_Chr4g0390251

UPF0481 protein At3g47200-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000417
Physical Location & Seq
Reverse (-)
5562220 .. 5562471
252 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36331

Sequence Viewer

Length: 252 bp
ATGGCGATGCATCATACTTCTATTGGTATGGAATTCCATGATTGCACGAAATGCAAGAAATTATGCAAGAAATGCATCTTCATAGTTCCTAAGGTGCTCCGGAGACAAAACTCTGAAGCATATACGCCTGACATAGTCTCAATTGGACCTTTCCATCGTCGAGGAAAGGGAAGCAAGGGAGTCAGAGAATGCGAGGAATGCAAGGAATGCAAATTATGCGAAAAAAGGCAAGAAAGTCAAGGAAGGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

83

Amino Acids

9.6

Weight (kDa)

9.26

Isoelectric Point (pI)

70.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 26 - 75 5e-10 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000417)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g32770 FvH4_4g02520 FvH4_4g02520 FvH4_4g02530 FvH4_4g02550 FvH4_4g17730 FvH4_4g17730
rosa_chinensis RchiOBHm_Chr1g0318801 RchiOBHm_Chr4g0390011 RchiOBHm_Chr4g0390031 RchiOBHm_Chr4g0390041 RchiOBHm_Chr4g0390061 RchiOBHm_Chr4g0390091 RchiOBHm_Chr4g0390101 RchiOBHm_Chr4g0390141 RchiOBHm_Chr4g0390181 RchiOBHm_Chr4g0390191 RchiOBHm_Chr4g0390201 RchiOBHm_Chr4g0390231 RchiOBHm_Chr4g0390241 RchiOBHm_Chr4g0390251 RchiOBHm_Chr4g0390661 RchiOBHm_Chr4g0390711 RchiOBHm_Chr4g0390741 RchiOBHm_Chr4g0390771 RchiOBHm_Chr4g0390801 RchiOBHm_Chr5g0058271
rosa_laevigata RLG00000008685 RLG00000009910 RLG00000009930 RLG00000009932 RLG00000009933 RLG00000009934 RLG00000009935 RLG00000009937 RLG00000009938 RLG00000009940 RLG00000035208 RLG00000035209
rosa_multiflora Rmu_co8281525.1_g000001 Rmu_co8464925.1_g000001 Rmu_sc0000171.1_g000023 Rmu_sc0000171.1_g000027 Rmu_sc0000367.1_g000061 Rmu_sc0000679.1_g000027 Rmu_sc0001380.1_g000026 Rmu_sc0001380.1_g000030 Rmu_sc0001471.1_g000010 Rmu_sc0003643.1_g000007 Rmu_sc0004336.1_g000002 Rmu_sc0004336.1_g000011 Rmu_sc0004336.1_g000012 Rmu_sc0005003.1_g000007 Rmu_sc0005003.1_g000012 Rmu_sc0005003.1_g000016 Rmu_sc0005003.1_g000022 Rmu_sc0008322.1_g000002 Rmu_sc0011197.1_g000004 Rmu_sc0014620.1_g000006 Rmu_sc0014620.1_g000017 Rmu_sc0018617.1_g000002
rosa_roxburghii Rroxscaffold_1G00022270 Rroxscaffold_5G00336180 Rroxscaffold_5G00336220 Rroxscaffold_5G00336240 Rroxscaffold_5G00336250 Rroxscaffold_5G00336290 Rroxscaffold_5G00336310 Rroxscaffold_5G00336350 Rroxscaffold_5G00336370 Rroxscaffold_5G00336670 Rroxscaffold_5G00336700 Rroxscaffold_5G00336710
rosa_rugosa Rorug01G0020300 Rorug03G0327700 Rorug03G0327800 Rorug03G0328000 Rorug03G0328100 Rorug03G0328300 Rorug03G0328600 Rorug03G0328600 Rorug03G0331700 Rorug03G0331800 Rorug05G0312900
rosa_samantha Rh4DG024700 Rh4DG024900 Rh4DG025000 Rh4DG025200 Rh4DG025500 Rh4DG025900 Rh4DG026200 Rh4DG030200 Rh5DG407000
rosa_wichuraiana Rw4G002360 Rw4G002410 Rw4G002420 Rw4G002450 Rw4G002480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 99
AcsI RAATTY 1 cut(s) 32
AcuI CTGAAG 1 cut(s) 135
Alw21I GWGCWC 1 cut(s) 99
Alw26I GTCTC 2 cut(s) 97, 142
Aor13HI TCCGGA 1 cut(s) 99
ApoI RAATTY 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 146
AvaII GGWCC 1 cut(s) 146
AxyI CCTNAGG 1 cut(s) 90
Bbv12I GWGCWC 1 cut(s) 99
BccI CCATC 1 cut(s) 162
BcoDI GTCTC 2 cut(s) 97, 142
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 146
BmsI GCATC 2 cut(s) 19, 84
BsaWI WCCGGW 1 cut(s) 99
Bse21I CCTNAGG 1 cut(s) 90
BseAI TCCGGA 1 cut(s) 99
BsiHKAI GWGCWC 1 cut(s) 99
BsiSI CCGG 1 cut(s) 100
BsmAI GTCTC 2 cut(s) 97, 142
BsmI GAATGC 3 cut(s) 194, 203, 212
Bsp1286I GDGCHC 1 cut(s) 99
Bsp13I TCCGGA 1 cut(s) 99
BspEI TCCGGA 1 cut(s) 99
BstAPI GCANNNNNTGC 4 cut(s) 51, 72, 207, 216
BstDEI CTNAG 1 cut(s) 90
BstMAI GTCTC 2 cut(s) 97, 142
BstMWI GCNNNNNNNGC 5 cut(s) 51, 72, 198, 207, 216
Bsu36I CCTNAGG 1 cut(s) 90
BtgZI GCGATG 1 cut(s) 20
Cfr13I GGNCC 1 cut(s) 146
CviAII CATG 1 cut(s) 38
DdeI CTNAG 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 146
Eco57I CTGAAG 1 cut(s) 135
Eco81I CCTNAGG 1 cut(s) 90
EcoRI GAATTC 1 cut(s) 32
EcoT22I ATGCAT 2 cut(s) 12, 77
FaeI CATG 1 cut(s) 41
FaiI YATR 9 cut(s) 15, 29, 39, 64, 83, 121, 123, 134, 217
FatI CATG 1 cut(s) 37
HapII CCGG 1 cut(s) 100
Hin1II CATG 1 cut(s) 41
HinfI GANTC 1 cut(s) 180
HpaII CCGG 1 cut(s) 100
Hpy188I TCNGA 2 cut(s) 115, 185
Hpy188III TCNNGA 1 cut(s) 100
Hpy99I CGWCG 1 cut(s) 162
HpyAV CCTTC 1 cut(s) 237
HpyCH4V TGCA 7 cut(s) 10, 45, 54, 66, 75, 201, 210
HpyF10VI GCNNNNNNNGC 5 cut(s) 51, 72, 198, 207, 216
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 1 cut(s) 41
Kpn2I TCCGGA 1 cut(s) 99
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 2 cut(s) 113, 141
LweI GCATC 2 cut(s) 19, 84
MboII GAAGA 1 cut(s) 70
MfeI CAATTG 1 cut(s) 141
MhlI GDGCHC 1 cut(s) 99
MluCI AATT 4 cut(s) 32, 59, 141, 212
MlyI GAGTC 1 cut(s) 189
MnlI CCTC 2 cut(s) 155, 187
Mph1103I ATGCAT 2 cut(s) 12, 77
MroI TCCGGA 1 cut(s) 99
MspI CCGG 1 cut(s) 100
MunI CAATTG 1 cut(s) 141
Mva1269I GAATGC 3 cut(s) 194, 203, 212
MwoI GCNNNNNNNGC 5 cut(s) 51, 72, 198, 207, 216
NlaIII CATG 1 cut(s) 41
NsiI ATGCAT 2 cut(s) 12, 77
PctI GAATGC 3 cut(s) 194, 203, 212
PflFI GACNNNGTC 1 cut(s) 134
PleI GAGTC 1 cut(s) 188
PpsI GAGTC 1 cut(s) 188
PspPI GGNCC 1 cut(s) 146
PsyI GACNNNGTC 1 cut(s) 134
Sau96I GGNCC 1 cut(s) 146
SchI GAGTC 1 cut(s) 189
SduI GDGCHC 1 cut(s) 99
SetI ASST 2 cut(s) 96, 151
SfaNI GCATC 2 cut(s) 19, 84
SinI GGWCC 1 cut(s) 146
Sse9I AATT 4 cut(s) 32, 59, 141, 212
TaqI TCGA 1 cut(s) 160
TasI AATT 4 cut(s) 32, 59, 141, 212
TspDTI ATGAA 1 cut(s) 70
Tth111I GACNNNGTC 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 146
XapI RAATTY 1 cut(s) 32
Zsp2I ATGCAT 2 cut(s) 12, 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.