Rh4DG024900

UPF0481 protein At3g47200-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0000417
Physical Location & Seq
Reverse (-)
4598144 .. 4604170
6027 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG024900.1

Sequence Viewer

Length: 333 bp
ATGTCTGCAAATCGTGAAAGTGGTAGAGATCATACAGTTATTGATATTATCGATGACCGCGAGAAAAGCAAGAAAAGCATGAAATGCAAGAAATGCATCTTCAGAGTTCCTAACGTGCTCCGGAGACAAAACCCAGAAGCATATACACCTGACGTTGTTTCAATCGGACCTTTTCATCATTATCGAGAAAAACGAGGCAAGGAGGAAGGTAAAGGAGTCAAGGAAGGCAAACAACGCATAGGCGAGGAAGATTTCCAACTTACGAAACGAGTGAAAAAGAGCTATTTGAATGAAATTCTCACAGCTAATCCCTTTGTTACTGAAGGTCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

110

Amino Acids

12.75

Weight (kDa)

9.54

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 33 - 101 1.7e-11 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000417)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g32770 FvH4_4g02520 FvH4_4g02520 FvH4_4g02530 FvH4_4g02550 FvH4_4g17730 FvH4_4g17730
rosa_chinensis RchiOBHm_Chr1g0318801 RchiOBHm_Chr4g0390011 RchiOBHm_Chr4g0390031 RchiOBHm_Chr4g0390041 RchiOBHm_Chr4g0390061 RchiOBHm_Chr4g0390091 RchiOBHm_Chr4g0390101 RchiOBHm_Chr4g0390141 RchiOBHm_Chr4g0390181 RchiOBHm_Chr4g0390191 RchiOBHm_Chr4g0390201 RchiOBHm_Chr4g0390231 RchiOBHm_Chr4g0390241 RchiOBHm_Chr4g0390251 RchiOBHm_Chr4g0390661 RchiOBHm_Chr4g0390711 RchiOBHm_Chr4g0390741 RchiOBHm_Chr4g0390771 RchiOBHm_Chr4g0390801 RchiOBHm_Chr5g0058271
rosa_laevigata RLG00000008685 RLG00000009910 RLG00000009930 RLG00000009932 RLG00000009933 RLG00000009934 RLG00000009935 RLG00000009937 RLG00000009938 RLG00000009940 RLG00000035208 RLG00000035209
rosa_multiflora Rmu_co8281525.1_g000001 Rmu_co8464925.1_g000001 Rmu_sc0000171.1_g000023 Rmu_sc0000171.1_g000027 Rmu_sc0000367.1_g000061 Rmu_sc0000679.1_g000027 Rmu_sc0001380.1_g000026 Rmu_sc0001380.1_g000030 Rmu_sc0001471.1_g000010 Rmu_sc0003643.1_g000007 Rmu_sc0004336.1_g000002 Rmu_sc0004336.1_g000011 Rmu_sc0004336.1_g000012 Rmu_sc0005003.1_g000007 Rmu_sc0005003.1_g000012 Rmu_sc0005003.1_g000016 Rmu_sc0005003.1_g000022 Rmu_sc0008322.1_g000002 Rmu_sc0011197.1_g000004 Rmu_sc0014620.1_g000006 Rmu_sc0014620.1_g000017 Rmu_sc0018617.1_g000002
rosa_roxburghii Rroxscaffold_1G00022270 Rroxscaffold_5G00336180 Rroxscaffold_5G00336220 Rroxscaffold_5G00336240 Rroxscaffold_5G00336250 Rroxscaffold_5G00336290 Rroxscaffold_5G00336310 Rroxscaffold_5G00336350 Rroxscaffold_5G00336370 Rroxscaffold_5G00336670 Rroxscaffold_5G00336700 Rroxscaffold_5G00336710
rosa_rugosa Rorug01G0020300 Rorug03G0327700 Rorug03G0327800 Rorug03G0328000 Rorug03G0328100 Rorug03G0328300 Rorug03G0328600 Rorug03G0328600 Rorug03G0331700 Rorug03G0331800 Rorug05G0312900
rosa_samantha Rh4DG024700 Rh4DG024900 Rh4DG025000 Rh4DG025200 Rh4DG025500 Rh4DG025900 Rh4DG026200 Rh4DG030200 Rh5DG407000
rosa_wichuraiana Rw4G002360 Rw4G002410 Rw4G002420 Rw4G002450 Rw4G002480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 60
AccIII TCCGGA 1 cut(s) 120
AciI CCGC 1 cut(s) 58
AcsI RAATTY 1 cut(s) 294
AcuI CTGAAG 1 cut(s) 85
AgsI TTSAA 2 cut(s) 162, 289
AluBI AGCT 2 cut(s) 282, 305
AluI AGCT 2 cut(s) 282, 305
Alw21I GWGCWC 1 cut(s) 120
Alw26I GTCTC 1 cut(s) 118
Aor13HI TCCGGA 1 cut(s) 120
ApoI RAATTY 1 cut(s) 294
AspS9I GGNCC 1 cut(s) 167
AvaII GGWCC 1 cut(s) 167
Bbv12I GWGCWC 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BmsI GCATC 1 cut(s) 105
Bsa29I ATCGAT 1 cut(s) 51
BsaWI WCCGGW 1 cut(s) 120
BseAI TCCGGA 1 cut(s) 120
BseCI ATCGAT 1 cut(s) 51
Bsh1236I CGCG 1 cut(s) 60
BshVI ATCGAT 1 cut(s) 51
BsiHKAI GWGCWC 1 cut(s) 120
BsiSI CCGG 1 cut(s) 121
BsmAI GTCTC 1 cut(s) 118
Bsp1286I GDGCHC 1 cut(s) 120
Bsp13I TCCGGA 1 cut(s) 120
Bsp143I GATC 1 cut(s) 28
BspACI CCGC 1 cut(s) 58
BspDI ATCGAT 1 cut(s) 51
BspEI TCCGGA 1 cut(s) 120
BspFNI CGCG 1 cut(s) 60
BssMI GATC 1 cut(s) 28
Bst4CI ACNGT 1 cut(s) 37
BstAPI GCANNNNNTGC 2 cut(s) 84, 93
BstFNI CGCG 1 cut(s) 60
BstKTI GATC 1 cut(s) 31
BstMAI GTCTC 1 cut(s) 118
BstMBI GATC 1 cut(s) 28
BstMWI GCNNNNNNNGC 5 cut(s) 66, 75, 84, 93, 234
BstUI CGCG 1 cut(s) 60
Bsu15I ATCGAT 1 cut(s) 51
BsuTUI ATCGAT 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 167
ClaI ATCGAT 1 cut(s) 51
CviAII CATG 1 cut(s) 79
CviJI RGCY 2 cut(s) 282, 305
CviKI_1 RGCY 2 cut(s) 282, 305
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
Eco47I GGWCC 1 cut(s) 167
Eco57I CTGAAG 1 cut(s) 85
EcoT22I ATGCAT 1 cut(s) 98
FaeI CATG 1 cut(s) 82
FaiI YATR 5 cut(s) 33, 80, 142, 144, 239
FatI CATG 1 cut(s) 78
HapII CCGG 1 cut(s) 121
Hin1II CATG 1 cut(s) 82
HinfI GANTC 1 cut(s) 216
HpaII CCGG 1 cut(s) 121
Hpy188I TCNGA 2 cut(s) 104, 167
Hpy188III TCNNGA 3 cut(s) 14, 121, 185
HpyAV CCTTC 3 cut(s) 200, 218, 317
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4IV ACGT 2 cut(s) 114, 153
HpyCH4V TGCA 3 cut(s) 8, 87, 96
HpyF10VI GCNNNNNNNGC 5 cut(s) 66, 75, 84, 93, 234
HpySE526I ACGT 2 cut(s) 114, 153
Hsp92II CATG 1 cut(s) 82
Kpn2I TCCGGA 1 cut(s) 120
Kzo9I GATC 1 cut(s) 28
LmnI GCTCC 1 cut(s) 123
LpnPI CCDG 3 cut(s) 134, 147, 162
LweI GCATC 1 cut(s) 105
MaeII ACGT 2 cut(s) 114, 153
MaeIII GTNAC 1 cut(s) 316
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 2 cut(s) 91, 260
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 1 cut(s) 294
MlyI GAGTC 1 cut(s) 225
MmeI TCCRAC 1 cut(s) 280
MnlI CCTC 3 cut(s) 188, 196, 238
Mph1103I ATGCAT 1 cut(s) 98
MroI TCCGGA 1 cut(s) 120
MspI CCGG 1 cut(s) 121
MvnI CGCG 1 cut(s) 60
MwoI GCNNNNNNNGC 5 cut(s) 66, 75, 84, 93, 234
NdeII GATC 1 cut(s) 28
NlaIII CATG 1 cut(s) 82
NsiI ATGCAT 1 cut(s) 98
PcsI WCGNNNNNNNCGW 2 cut(s) 57, 190
PleI GAGTC 1 cut(s) 224
PpsI GAGTC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 167
Sau3AI GATC 1 cut(s) 28
Sau96I GGNCC 1 cut(s) 167
SchI GAGTC 1 cut(s) 225
SduI GDGCHC 1 cut(s) 120
SetI ASST 8 cut(s) 117, 151, 156, 172, 211, 284, 307, 328
SfaNI GCATC 1 cut(s) 105
SinI GGWCC 1 cut(s) 167
Sse9I AATT 1 cut(s) 294
SsiI CCGC 1 cut(s) 58
TaaI ACNGT 1 cut(s) 37
TaiI ACGT 2 cut(s) 117, 156
TaqI TCGA 2 cut(s) 51, 184
TasI AATT 1 cut(s) 294
TspDTI ATGAA 3 cut(s) 95, 164, 306
VpaK11BI GGWCC 1 cut(s) 167
XapI RAATTY 1 cut(s) 294
Zsp2I ATGCAT 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.