Rmu_sc0008322.1_g000002

UPF0481 protein At3g47200-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008322.1
OG0000417
Physical Location & Seq
Forward (+)
1702 .. 2322
621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008322.1_g000002.1.cds

Sequence Viewer

Length: 621 bp
atgaaggcaagagcgacaataaaactgttcaatcgtaaagctaattttgacccagatcaacatcaaatgcataccgcgacagctctctcaaaagcaaacattaaattccaacctgtcataaaggaaaccataatggacatccgattcaaagaaggtcggtgttgcaggaatgggattcttgtgattccacaaataaacgttggaatgtcatcggaaacattattccggaaccttattgcaatcaagcaatgctaccatggttattcgaatgaaattacatcttatgtcatcttgatggataaccttgtctcttccaaggaagatatggaattactatgcaaggaaaaagcaataggtaactggttgagtgatgaaaatggttgtaagttctttagcaacctttacaaggacatcccgcacaacaaattctactatagtgctctatgcaagcaagtgaatgatcgttacaaactaaggcggtacacatggttgttgacttcactcaagagtgacaaattttccaacccctggaaaattttggctctcgtggtaggtattatcgttttgatgctcagcgtatggagtcagacaaacaacatccggacttccttacagaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

206

Amino Acids

23.93

Weight (kDa)

9.55

Isoelectric Point (pI)

30.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000417)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g32770 FvH4_4g02520 FvH4_4g02520 FvH4_4g02530 FvH4_4g02550 FvH4_4g17730 FvH4_4g17730
rosa_chinensis RchiOBHm_Chr1g0318801 RchiOBHm_Chr4g0390011 RchiOBHm_Chr4g0390031 RchiOBHm_Chr4g0390041 RchiOBHm_Chr4g0390061 RchiOBHm_Chr4g0390091 RchiOBHm_Chr4g0390101 RchiOBHm_Chr4g0390141 RchiOBHm_Chr4g0390181 RchiOBHm_Chr4g0390191 RchiOBHm_Chr4g0390201 RchiOBHm_Chr4g0390231 RchiOBHm_Chr4g0390241 RchiOBHm_Chr4g0390251 RchiOBHm_Chr4g0390661 RchiOBHm_Chr4g0390711 RchiOBHm_Chr4g0390741 RchiOBHm_Chr4g0390771 RchiOBHm_Chr4g0390801 RchiOBHm_Chr5g0058271
rosa_laevigata RLG00000008685 RLG00000009910 RLG00000009930 RLG00000009932 RLG00000009933 RLG00000009934 RLG00000009935 RLG00000009937 RLG00000009938 RLG00000009940 RLG00000035208 RLG00000035209
rosa_multiflora Rmu_co8281525.1_g000001 Rmu_co8464925.1_g000001 Rmu_sc0000171.1_g000023 Rmu_sc0000171.1_g000027 Rmu_sc0000367.1_g000061 Rmu_sc0000679.1_g000027 Rmu_sc0001380.1_g000026 Rmu_sc0001380.1_g000030 Rmu_sc0001471.1_g000010 Rmu_sc0003643.1_g000007 Rmu_sc0004336.1_g000002 Rmu_sc0004336.1_g000011 Rmu_sc0004336.1_g000012 Rmu_sc0005003.1_g000007 Rmu_sc0005003.1_g000012 Rmu_sc0005003.1_g000016 Rmu_sc0005003.1_g000022 Rmu_sc0008322.1_g000002 Rmu_sc0011197.1_g000004 Rmu_sc0014620.1_g000006 Rmu_sc0014620.1_g000017 Rmu_sc0018617.1_g000002
rosa_roxburghii Rroxscaffold_1G00022270 Rroxscaffold_5G00336180 Rroxscaffold_5G00336220 Rroxscaffold_5G00336240 Rroxscaffold_5G00336250 Rroxscaffold_5G00336290 Rroxscaffold_5G00336310 Rroxscaffold_5G00336350 Rroxscaffold_5G00336370 Rroxscaffold_5G00336670 Rroxscaffold_5G00336700 Rroxscaffold_5G00336710
rosa_rugosa Rorug01G0020300 Rorug03G0327700 Rorug03G0327800 Rorug03G0328000 Rorug03G0328100 Rorug03G0328300 Rorug03G0328600 Rorug03G0328600 Rorug03G0331700 Rorug03G0331800 Rorug05G0312900
rosa_samantha Rh4DG024700 Rh4DG024900 Rh4DG025000 Rh4DG025200 Rh4DG025500 Rh4DG025900 Rh4DG026200 Rh4DG030200 Rh5DG407000
rosa_wichuraiana Rw4G002360 Rw4G002410 Rw4G002420 Rw4G002450 Rw4G002480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 528
AccII CGCG 1 cut(s) 77
AccIII TCCGGA 2 cut(s) 225, 600
AciI CCGC 3 cut(s) 75, 416, 478
AclI AACGTT 1 cut(s) 198
AcsI RAATTY 4 cut(s) 104, 425, 515, 534
AfaI GTAC 1 cut(s) 482
AfiI CCNNNNNNNGG 2 cut(s) 406, 528
AgsI TTSAA 2 cut(s) 31, 148
AjnI CCWGG 1 cut(s) 527
AluBI AGCT 2 cut(s) 41, 83
AluI AGCT 2 cut(s) 41, 83
Alw21I GWGCWC 1 cut(s) 442
Alw26I GTCTC 1 cut(s) 313
Aor13HI TCCGGA 2 cut(s) 225, 600
ApoI RAATTY 4 cut(s) 104, 425, 515, 534
AsuII TTCGAA 1 cut(s) 266
BauI CACGAG 1 cut(s) 545
Bbv12I GWGCWC 1 cut(s) 442
BccI CCATC 1 cut(s) 289
BciT130I CCWGG 1 cut(s) 529
BcoDI GTCTC 1 cut(s) 313
BfmI CTRYAG 1 cut(s) 433
BlpI GCTNAGC 1 cut(s) 572
Bme1390I CCNGG 1 cut(s) 529
BmiI GGNNCC 1 cut(s) 230
BmrFI CCNGG 1 cut(s) 529
BmsI GCATC 1 cut(s) 558
Bpu1102I GCTNAGC 1 cut(s) 572
Bpu14I TTCGAA 1 cut(s) 266
BpuEI CTTGAG 1 cut(s) 488
BsaBI GATNNNNATC 1 cut(s) 60
BsaJI CCNNGG 3 cut(s) 256, 315, 527
BsaWI WCCGGW 2 cut(s) 225, 600
Bsc4I CCNNNNNNNGG 2 cut(s) 406, 528
Bse1I ACTGG 1 cut(s) 365
Bse3DI GCAATG 1 cut(s) 254
Bse8I GATNNNNATC 1 cut(s) 60
BseAI TCCGGA 2 cut(s) 225, 600
BseBI CCWGG 1 cut(s) 529
BseDI CCNNGG 3 cut(s) 256, 315, 527
BseGI GGATG 3 cut(s) 138, 411, 597
BseJI GATNNNNATC 1 cut(s) 60
BseLI CCNNNNNNNGG 2 cut(s) 406, 528
BseMI GCAATG 1 cut(s) 254
BseMII CTCAG 1 cut(s) 586
BseNI ACTGG 1 cut(s) 365
Bsh1236I CGCG 1 cut(s) 77
BsiHKAI GWGCWC 1 cut(s) 442
BsiSI CCGG 2 cut(s) 226, 601
BslI CCNNNNNNNGG 2 cut(s) 406, 528
BsmAI GTCTC 1 cut(s) 313
Bsp119I TTCGAA 1 cut(s) 266
Bsp1286I GDGCHC 1 cut(s) 442
Bsp13I TCCGGA 2 cut(s) 225, 600
Bsp143I GATC 2 cut(s) 55, 460
Bsp1720I GCTNAGC 1 cut(s) 572
Bsp19I CCATGG 1 cut(s) 256
BspACI CCGC 3 cut(s) 75, 416, 478
BspCNI CTCAG 1 cut(s) 585
BspEI TCCGGA 2 cut(s) 225, 600
BspFNI CGCG 1 cut(s) 77
BspLI GGNNCC 1 cut(s) 230
BspT104I TTCGAA 1 cut(s) 266
BsrDI GCAATG 1 cut(s) 254
BsrI ACTGG 1 cut(s) 365
BssECI CCNNGG 3 cut(s) 256, 315, 527
BssMI GATC 2 cut(s) 55, 460
BssSI CACGAG 1 cut(s) 545
BssT1I CCWWGG 2 cut(s) 256, 315
Bst2BI CACGAG 1 cut(s) 545
Bst2UI CCWGG 1 cut(s) 529
Bst4CI ACNGT 1 cut(s) 27
Bst6I CTCTTC 1 cut(s) 316
BstBI TTCGAA 1 cut(s) 266
BstC8I GCNNGC 1 cut(s) 449
BstDEI CTNAG 2 cut(s) 473, 572
BstDSI CCRYGG 1 cut(s) 256
BstENI CCTNNNNNAGG 1 cut(s) 404
BstF5I GGATG 3 cut(s) 138, 411, 597
BstFNI CGCG 1 cut(s) 77
BstKTI GATC 2 cut(s) 58, 463
BstMAI GTCTC 1 cut(s) 313
BstMBI GATC 2 cut(s) 55, 460
BstNI CCWGG 1 cut(s) 529
BstSCI CCNGG 1 cut(s) 527
BstSFI CTRYAG 1 cut(s) 433
BstUI CGCG 1 cut(s) 77
BtgI CCRYGG 1 cut(s) 256
BtsCI GGATG 3 cut(s) 138, 411, 597
Cac8I GCNNGC 1 cut(s) 449
Csp6I GTAC 1 cut(s) 481
CviAII CATG 2 cut(s) 257, 486
CviJI RGCY 3 cut(s) 41, 83, 542
CviKI_1 RGCY 3 cut(s) 41, 83, 542
CviQI GTAC 1 cut(s) 481
DdeI CTNAG 2 cut(s) 473, 572
DpnI GATC 2 cut(s) 57, 462
DpnII GATC 2 cut(s) 55, 460
Eam1104I CTCTTC 1 cut(s) 316
EarI CTCTTC 1 cut(s) 316
Eco130I CCWWGG 2 cut(s) 256, 315
EcoNI CCTNNNNNAGG 1 cut(s) 404
EcoRII CCWGG 1 cut(s) 527
EcoT14I CCWWGG 2 cut(s) 256, 315
EcoT22I ATGCAT 1 cut(s) 72
ErhI CCWWGG 2 cut(s) 256, 315
FaeI CATG 2 cut(s) 260, 489
FatI CATG 2 cut(s) 256, 485
FauI CCCGC 1 cut(s) 423
FokI GGATG 3 cut(s) 125, 398, 584
HapII CCGG 2 cut(s) 226, 601
Hin1II CATG 2 cut(s) 260, 489
HincII GTYRAC 1 cut(s) 495
HindII GTYRAC 1 cut(s) 495
HinfI GANTC 4 cut(s) 144, 175, 184, 583
HpaII CCGG 2 cut(s) 226, 601
Hpy166II GTNNAC 2 cut(s) 483, 495
Hpy188I TCNGA 3 cut(s) 143, 214, 588
Hpy188III TCNNGA 4 cut(s) 226, 292, 505, 601
Hpy8I GTNNAC 2 cut(s) 483, 495
HpyAV CCTTC 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 27
HpyCH4IV ACGT 1 cut(s) 198
HpyCH4V TGCA 5 cut(s) 70, 165, 239, 339, 447
HpyF3I CTNAG 2 cut(s) 473, 572
HpySE526I ACGT 1 cut(s) 198
Hsp92II CATG 2 cut(s) 260, 489
Kpn2I TCCGGA 2 cut(s) 225, 600
Kzo9I GATC 2 cut(s) 55, 460
LpnPI CCDG 8 cut(s) 66, 126, 151, 239, 346, 514, 541, 614
LweI GCATC 1 cut(s) 558
MaeII ACGT 1 cut(s) 198
MaeIII GTNAC 3 cut(s) 356, 464, 509
MalI GATC 2 cut(s) 57, 462
MboI GATC 2 cut(s) 55, 460
MboII GAAGA 2 cut(s) 303, 332
MhlI GDGCHC 1 cut(s) 442
MluCI AATT 7 cut(s) 43, 104, 273, 329, 425, 515, 534
MlyI GAGTC 1 cut(s) 592
MmeI TCCRAC 3 cut(s) 133, 181, 546
Mph1103I ATGCAT 1 cut(s) 72
MroI TCCGGA 2 cut(s) 225, 600
MseI TTAA 1 cut(s) 102
MslI CAYNNNNRTG 1 cut(s) 293
MspI CCGG 2 cut(s) 226, 601
MspR9I CCNGG 1 cut(s) 529
MvaI CCWGG 1 cut(s) 529
MvnI CGCG 1 cut(s) 77
NcoI CCATGG 1 cut(s) 256
NdeII GATC 2 cut(s) 55, 460
NlaIII CATG 2 cut(s) 260, 489
NlaIV GGNNCC 1 cut(s) 230
NmuCI GTSAC 1 cut(s) 509
NsiI ATGCAT 1 cut(s) 72
NspV TTCGAA 1 cut(s) 266
PfeI GAWTC 3 cut(s) 144, 175, 184
PflMI CCANNNNNTGG 1 cut(s) 528
PleI GAGTC 1 cut(s) 591
PpsI GAGTC 1 cut(s) 591
Psp1406I AACGTT 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 527
PspGI CCWGG 1 cut(s) 527
PspN4I GGNNCC 1 cut(s) 230
RsaI GTAC 1 cut(s) 482
RsaNI GTAC 1 cut(s) 481
RseI CAYNNNNRTG 1 cut(s) 293
SaqAI TTAA 1 cut(s) 102
Sau3AI GATC 2 cut(s) 55, 460
SchI GAGTC 1 cut(s) 592
ScrFI CCNGG 1 cut(s) 529
SduI GDGCHC 1 cut(s) 442
SfaNI GCATC 1 cut(s) 558
SfcI CTRYAG 1 cut(s) 433
SfuI TTCGAA 1 cut(s) 266
SmiMI CAYNNNNRTG 1 cut(s) 293
SmlI CTYRAG 1 cut(s) 503
SmoI CTYRAG 1 cut(s) 503
Sse9I AATT 7 cut(s) 43, 104, 273, 329, 425, 515, 534
SsiI CCGC 3 cut(s) 75, 416, 478
StyD4I CCNGG 1 cut(s) 527
StyI CCWWGG 2 cut(s) 256, 315
TaaI ACNGT 1 cut(s) 27
TaiI ACGT 1 cut(s) 201
TaqI TCGA 1 cut(s) 266
TasI AATT 7 cut(s) 43, 104, 273, 329, 425, 515, 534
TfiI GAWTC 3 cut(s) 144, 175, 184
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TseFI GTSAC 1 cut(s) 509
Tsp45I GTSAC 1 cut(s) 509
TspDTI ATGAA 3 cut(s) 17, 285, 387
Van91I CCANNNNNTGG 1 cut(s) 528
XagI CCTNNNNNAGG 1 cut(s) 404
XapI RAATTY 4 cut(s) 104, 425, 515, 534
XcmI CCANNNNNNNNNTGG 1 cut(s) 322
Zsp2I ATGCAT 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.