Rmu_co8202712.1_g000001
NAC Family

(NAC) domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8202712.1
Physical Location & Seq
Forward (+)
142 .. 492
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8202712.1_g000001.1.cds

Sequence Viewer

Length: 351 bp
atgactctggatcagcttgatgtgggtgtggtgaagacatttcaccctactgaagccgagttggtgggtttctttctatacaacaagatctccatggcctcaagctcaggcaatcagattcagacattccctaaaatttgtatatatggtgagacaggcttaccaccttgggagatatggaggatatatcagcaattcaagtttccccaccaggattttctctacttcttctcctggaccaagaaggttagccccaacaaatctcgcaactctggcacagttagctctgatgggggaacatggagagagacggaagccgctaggcctgtgtatattagaggaagtgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.32

Weight (kDa)

7.86

Isoelectric Point (pI)

33.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000636)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 318
AclWI GGATC 1 cut(s) 18
AcsI RAATTY 1 cut(s) 135
AcuI CTGAAG 1 cut(s) 72
AgsI TTSAA 1 cut(s) 199
AjnI CCWGG 2 cut(s) 210, 233
AluBI AGCT 3 cut(s) 16, 105, 285
AluI AGCT 3 cut(s) 16, 105, 285
Alw26I GTCTC 2 cut(s) 146, 302
AlwI GGATC 1 cut(s) 18
AoxI GGCC 2 cut(s) 96, 323
ApoI RAATTY 1 cut(s) 135
AspS9I GGNCC 1 cut(s) 237
AsuHPI GGTGA 3 cut(s) 35, 43, 161
AvaII GGWCC 1 cut(s) 237
BbsI GAAGAC 1 cut(s) 41
BccI CCATC 1 cut(s) 284
BciT130I CCWGG 2 cut(s) 212, 235
BcoDI GTCTC 2 cut(s) 146, 302
BfaI CTAG 1 cut(s) 321
BglII AGATCT 1 cut(s) 87
BisI GCNGC 1 cut(s) 318
BlsI GCNGC 1 cut(s) 319
Bme1390I CCNGG 2 cut(s) 212, 235
Bme18I GGWCC 1 cut(s) 237
BmgT120I GGNCC 1 cut(s) 237
BmrFI CCNGG 2 cut(s) 212, 235
BpiI GAAGAC 1 cut(s) 41
Bpu10I CCTNAGC 1 cut(s) 106
BpuEI CTTGAG 1 cut(s) 85
BsaJI CCNNGG 2 cut(s) 93, 167
BsaXI ACNNNNNCTCC 4 cut(s) 74, 104, 215, 245
BseBI CCWGG 2 cut(s) 212, 235
BseDI CCNNGG 2 cut(s) 93, 167
BseMII CTCAG 1 cut(s) 120
BshFI GGCC 2 cut(s) 98, 325
BsmAI GTCTC 2 cut(s) 146, 302
BsmBI CGTCTC 1 cut(s) 302
BsnI GGCC 2 cut(s) 98, 325
Bsp143I GATC 2 cut(s) 10, 87
Bsp19I CCATGG 1 cut(s) 93
BspACI CCGC 1 cut(s) 318
BspANI GGCC 2 cut(s) 98, 325
BspCNI CTCAG 1 cut(s) 119
BspPI GGATC 1 cut(s) 18
BssECI CCNNGG 2 cut(s) 93, 167
BssMI GATC 2 cut(s) 10, 87
BssT1I CCWWGG 2 cut(s) 93, 167
Bst2UI CCWGG 2 cut(s) 212, 235
Bst4CI ACNGT 1 cut(s) 280
BstDEI CTNAG 1 cut(s) 106
BstDSI CCRYGG 1 cut(s) 93
BstKTI GATC 2 cut(s) 13, 90
BstMAI GTCTC 2 cut(s) 146, 302
BstMBI GATC 2 cut(s) 10, 87
BstMWI GCNNNNNNNGC 2 cut(s) 273, 282
BstNI CCWGG 2 cut(s) 212, 235
BstSCI CCNGG 2 cut(s) 210, 233
BstV2I GAAGAC 1 cut(s) 41
BstX2I RGATCY 1 cut(s) 87
BstYI RGATCY 1 cut(s) 87
BsuRI GGCC 2 cut(s) 98, 325
BtgI CCRYGG 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 237
CviAII CATG 2 cut(s) 94, 300
CviJI RGCY 9 cut(s) 16, 56, 98, 105, 159, 252, 285, 317, 325
CviKI_1 RGCY 9 cut(s) 16, 56, 98, 105, 159, 252, 285, 317, 325
DdeI CTNAG 1 cut(s) 106
DpnI GATC 2 cut(s) 12, 89
DpnII GATC 2 cut(s) 10, 87
Eco130I CCWWGG 2 cut(s) 93, 167
Eco147I AGGCCT 1 cut(s) 325
Eco47I GGWCC 1 cut(s) 237
Eco57I CTGAAG 1 cut(s) 72
EcoRII CCWGG 2 cut(s) 210, 233
EcoT14I CCWWGG 2 cut(s) 93, 167
ErhI CCWWGG 2 cut(s) 93, 167
Esp3I CGTCTC 1 cut(s) 302
FaeI CATG 2 cut(s) 97, 303
FaiI YATR 9 cut(s) 79, 95, 143, 145, 147, 178, 187, 301, 333
FatI CATG 2 cut(s) 93, 299
Fnu4HI GCNGC 1 cut(s) 318
Fsp4HI GCNGC 1 cut(s) 318
FspBI CTAG 1 cut(s) 321
GluI GCNGC 1 cut(s) 318
HaeIII GGCC 2 cut(s) 98, 325
Hin1II CATG 2 cut(s) 97, 303
HinfI GANTC 2 cut(s) 4, 118
HphI GGTGA 3 cut(s) 35, 43, 161
Hpy188I TCNGA 3 cut(s) 117, 123, 289
Hpy188III TCNNGA 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 238
HpyCH4III ACNGT 1 cut(s) 280
HpyF10VI GCNNNNNNNGC 2 cut(s) 273, 282
HpyF3I CTNAG 1 cut(s) 106
Hsp92II CATG 2 cut(s) 97, 303
Kzo9I GATC 2 cut(s) 10, 87
LpnPI CCDG 8 cut(s) 93, 141, 197, 220, 224, 247, 258, 339
MaeI CTAG 1 cut(s) 321
MalI GATC 2 cut(s) 12, 89
MboI GATC 2 cut(s) 10, 87
MboII GAAGA 2 cut(s) 46, 220
MflI RGATCY 1 cut(s) 87
MluCI AATT 2 cut(s) 135, 194
MnlI CCTC 3 cut(s) 109, 174, 332
MspR9I CCNGG 2 cut(s) 212, 235
MvaI CCWGG 2 cut(s) 212, 235
MwoI GCNNNNNNNGC 2 cut(s) 273, 282
NcoI CCATGG 1 cut(s) 93
NdeII GATC 2 cut(s) 10, 87
NlaIII CATG 2 cut(s) 97, 303
NmeAIII GCCGAG 1 cut(s) 82
PceI AGGCCT 1 cut(s) 325
PfeI GAWTC 1 cut(s) 118
PfoI TCCNGGA 1 cut(s) 233
PkrI GCNGC 1 cut(s) 319
Psp6I CCWGG 2 cut(s) 210, 233
PspGI CCWGG 2 cut(s) 210, 233
PspPI GGNCC 1 cut(s) 237
PsuI RGATCY 1 cut(s) 87
SatI GCNGC 1 cut(s) 318
Sau3AI GATC 2 cut(s) 10, 87
Sau96I GGNCC 1 cut(s) 237
ScrFI CCNGG 2 cut(s) 212, 235
SetI ASST 5 cut(s) 18, 107, 169, 249, 287
SinI GGWCC 1 cut(s) 237
SmlI CTYRAG 1 cut(s) 100
SmoI CTYRAG 1 cut(s) 100
Sse9I AATT 2 cut(s) 135, 194
SseBI AGGCCT 1 cut(s) 325
SsiI CCGC 1 cut(s) 318
SspMI CTAG 1 cut(s) 321
StuI AGGCCT 1 cut(s) 325
StyD4I CCNGG 2 cut(s) 210, 233
StyI CCWWGG 2 cut(s) 93, 167
TaaI ACNGT 1 cut(s) 280
TasI AATT 2 cut(s) 135, 194
TauI GCSGC 1 cut(s) 320
TfiI GAWTC 1 cut(s) 118
TspGWI ACGGA 1 cut(s) 326
VpaK11BI GGWCC 1 cut(s) 237
XapI RAATTY 1 cut(s) 135
XspI CTAG 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.