Rh5CG556100
NAC Family

(NAC) domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
77497475 .. 77497846
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG556100.1

Sequence Viewer

Length: 372 bp
ATGGCTCTCGTAGATCAATTCATGACTCTGGATCAGCTTGATGTGGGTGTGGTGAAGACATTTCACCCTACTGAAGCCGAGTTGGTGGGTTTCTTTCTATACAACAAGATCTCCATGGCCTCAAGCTCAGGCAATCAGATTCAGACATTCCCTAAAATTTGTATATATGGTGAGACAGGCTTACCACCTTGGGAGATATGGAGGATATATCAGCAATTCAAGTTTCCCCACCAGGATTTTCTCTACTTCTTCTCCTGGACCAAGAAGGTTAGCCCCAACAAATCTCGCAACTCTGGCACAGTTAGCTCTGATGGGGGAACATGGAGAGAGACGGAAGCCGCTAGGCCTGTGTATATTAGAGGAAGTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

14.13

Weight (kDa)

6.73

Isoelectric Point (pI)

31.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 20 - 117 1.2e-11 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000636)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 339
AclWI GGATC 1 cut(s) 39
AcsI RAATTY 1 cut(s) 156
AcuI CTGAAG 1 cut(s) 93
AgsI TTSAA 1 cut(s) 220
AjnI CCWGG 2 cut(s) 231, 254
AluBI AGCT 3 cut(s) 37, 126, 306
AluI AGCT 3 cut(s) 37, 126, 306
Alw26I GTCTC 2 cut(s) 167, 323
AlwI GGATC 1 cut(s) 39
AoxI GGCC 2 cut(s) 117, 344
ApoI RAATTY 1 cut(s) 156
AspS9I GGNCC 1 cut(s) 258
AsuHPI GGTGA 3 cut(s) 56, 64, 182
AvaII GGWCC 1 cut(s) 258
BbsI GAAGAC 1 cut(s) 62
BccI CCATC 1 cut(s) 305
BciT130I CCWGG 2 cut(s) 233, 256
BcoDI GTCTC 2 cut(s) 167, 323
BfaI CTAG 1 cut(s) 342
BglII AGATCT 1 cut(s) 108
BisI GCNGC 1 cut(s) 339
BlsI GCNGC 1 cut(s) 340
Bme1390I CCNGG 2 cut(s) 233, 256
Bme18I GGWCC 1 cut(s) 258
BmgT120I GGNCC 1 cut(s) 258
BmrFI CCNGG 2 cut(s) 233, 256
BpiI GAAGAC 1 cut(s) 62
Bpu10I CCTNAGC 1 cut(s) 127
BpuEI CTTGAG 1 cut(s) 106
BsaJI CCNNGG 2 cut(s) 114, 188
BsaXI ACNNNNNCTCC 4 cut(s) 95, 125, 236, 266
BseBI CCWGG 2 cut(s) 233, 256
BseDI CCNNGG 2 cut(s) 114, 188
BseMII CTCAG 1 cut(s) 141
BshFI GGCC 2 cut(s) 119, 346
BsmAI GTCTC 2 cut(s) 167, 323
BsmBI CGTCTC 1 cut(s) 323
BsnI GGCC 2 cut(s) 119, 346
Bsp143I GATC 3 cut(s) 13, 31, 108
Bsp19I CCATGG 1 cut(s) 114
BspACI CCGC 1 cut(s) 339
BspANI GGCC 2 cut(s) 119, 346
BspCNI CTCAG 1 cut(s) 140
BspHI TCATGA 1 cut(s) 21
BspPI GGATC 1 cut(s) 39
BssECI CCNNGG 2 cut(s) 114, 188
BssMI GATC 3 cut(s) 13, 31, 108
BssT1I CCWWGG 2 cut(s) 114, 188
Bst2UI CCWGG 2 cut(s) 233, 256
Bst4CI ACNGT 1 cut(s) 301
BstDEI CTNAG 1 cut(s) 127
BstDSI CCRYGG 1 cut(s) 114
BstKTI GATC 3 cut(s) 16, 34, 111
BstMAI GTCTC 2 cut(s) 167, 323
BstMBI GATC 3 cut(s) 13, 31, 108
BstMWI GCNNNNNNNGC 2 cut(s) 294, 303
BstNI CCWGG 2 cut(s) 233, 256
BstSCI CCNGG 2 cut(s) 231, 254
BstV2I GAAGAC 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
BsuRI GGCC 2 cut(s) 119, 346
BtgI CCRYGG 1 cut(s) 114
CciI TCATGA 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 258
CviAII CATG 3 cut(s) 22, 115, 321
DdeI CTNAG 1 cut(s) 127
DpnI GATC 3 cut(s) 15, 33, 110
DpnII GATC 3 cut(s) 13, 31, 108
Eco130I CCWWGG 2 cut(s) 114, 188
Eco147I AGGCCT 1 cut(s) 346
Eco47I GGWCC 1 cut(s) 258
Eco57I CTGAAG 1 cut(s) 93
EcoRII CCWGG 2 cut(s) 231, 254
EcoT14I CCWWGG 2 cut(s) 114, 188
ErhI CCWWGG 2 cut(s) 114, 188
Esp3I CGTCTC 1 cut(s) 323
FaeI CATG 3 cut(s) 25, 118, 324
FatI CATG 3 cut(s) 21, 114, 320
Fnu4HI GCNGC 1 cut(s) 339
Fsp4HI GCNGC 1 cut(s) 339
FspBI CTAG 1 cut(s) 342
GluI GCNGC 1 cut(s) 339
HaeIII GGCC 2 cut(s) 119, 346
Hin1II CATG 3 cut(s) 25, 118, 324
HinfI GANTC 2 cut(s) 25, 139
HphI GGTGA 3 cut(s) 56, 64, 182
Hpy188I TCNGA 3 cut(s) 138, 144, 310
Hpy188III TCNNGA 2 cut(s) 22, 29
HpyAV CCTTC 1 cut(s) 259
HpyCH4III ACNGT 1 cut(s) 301
HpyF10VI GCNNNNNNNGC 2 cut(s) 294, 303
HpyF3I CTNAG 1 cut(s) 127
Hsp92II CATG 3 cut(s) 25, 118, 324
Kzo9I GATC 3 cut(s) 13, 31, 108
LpnPI CCDG 9 cut(s) 14, 114, 162, 218, 241, 245, 268, 279, 360
MaeI CTAG 1 cut(s) 342
MalI GATC 3 cut(s) 15, 33, 110
MboI GATC 3 cut(s) 13, 31, 108
MboII GAAGA 2 cut(s) 67, 241
MflI RGATCY 1 cut(s) 108
MluCI AATT 3 cut(s) 17, 156, 215
MlyI GAGTC 1 cut(s) 19
MnlI CCTC 3 cut(s) 130, 195, 353
MspR9I CCNGG 2 cut(s) 233, 256
MvaI CCWGG 2 cut(s) 233, 256
MwoI GCNNNNNNNGC 2 cut(s) 294, 303
NcoI CCATGG 1 cut(s) 114
NdeII GATC 3 cut(s) 13, 31, 108
NlaIII CATG 3 cut(s) 25, 118, 324
NmeAIII GCCGAG 1 cut(s) 103
PagI TCATGA 1 cut(s) 21
PceI AGGCCT 1 cut(s) 346
PfeI GAWTC 1 cut(s) 139
PfoI TCCNGGA 1 cut(s) 254
PkrI GCNGC 1 cut(s) 340
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
Psp6I CCWGG 2 cut(s) 231, 254
PspGI CCWGG 2 cut(s) 231, 254
PspPI GGNCC 1 cut(s) 258
PsuI RGATCY 1 cut(s) 108
SatI GCNGC 1 cut(s) 339
Sau3AI GATC 3 cut(s) 13, 31, 108
Sau96I GGNCC 1 cut(s) 258
SchI GAGTC 1 cut(s) 19
ScrFI CCNGG 2 cut(s) 233, 256
SetI ASST 5 cut(s) 39, 128, 190, 270, 308
SinI GGWCC 1 cut(s) 258
SmlI CTYRAG 1 cut(s) 121
SmoI CTYRAG 1 cut(s) 121
Sse9I AATT 3 cut(s) 17, 156, 215
SseBI AGGCCT 1 cut(s) 346
SsiI CCGC 1 cut(s) 339
SspMI CTAG 1 cut(s) 342
StuI AGGCCT 1 cut(s) 346
StyD4I CCNGG 2 cut(s) 231, 254
StyI CCWWGG 2 cut(s) 114, 188
TaaI ACNGT 1 cut(s) 301
TasI AATT 3 cut(s) 17, 156, 215
TauI GCSGC 1 cut(s) 341
TfiI GAWTC 1 cut(s) 139
TspDTI ATGAA 1 cut(s) 10
TspGWI ACGGA 1 cut(s) 347
VpaK11BI GGWCC 1 cut(s) 258
XapI RAATTY 1 cut(s) 156
XspI CTAG 1 cut(s) 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.