Rmu_co8352639.1_g000001

Cyclic nucleotide-gated ion channel 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8352639.1
OG0000491
Physical Location & Seq
Reverse (-)
1 .. 1021
1021 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8352639.1_g000001.1.cds

Sequence Viewer

Length: 708 bp
atggttgcggctccaatatttgttccactggttgcaattcagtgggcatgtaaaccaattgcaacttggcgagcatgtaaatcaattgcgattgcaattaccgcaattcggtgggcatgtaaatcaattgcggttgcaatttggttggcatggaaatcaattgcggttgcaatttggtgggcatgcaagtcaattgcggttgcaattcggtgggcatggaaggcttttcttgacatcccttcagcaaagtgggaacatgtatttgtaatatcatgtattgcggtctcactggatcctctgttcttttacattccaatcatcgacgagacaaataaatgtctttcaatggacaaaaagttgagaactatagctctcgtcttccgatcgcttacggatgcccctttagtactccatattaaagatcaaatttgtgatcgggtcgactctgactaccccaactggtccgactctgactccaactccgactccgactccaacacctactccgactcccattctggggcaacatcgtcttcattgaagaagaggaccttctctattatagttaactgccttgccattcttcccataccacagatggctacactagttggcttttaccaaatgggagccgactcatcggcctttgaaatttctattaaaagaacaacgctccacgtttctcttgccctccagtatctgccaagg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
Ion_trans

Protein Analysis

236

Amino Acids

26.27

Weight (kDa)

8.77

Isoelectric Point (pI)

45.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000491)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g12100 FvH4_3g12110 FvH4_3g12111 FvH4_3g12120 FvH4_3g12120 FvH4_3g28952 FvH4_6g40660 FvH4_6g40661 FvH4_6g40960
rosa_chinensis RchiOBHm_Chr1g0340941 RchiOBHm_Chr2g0156041 RchiOBHm_Chr2g0156591 RchiOBHm_Chr5g0019791 RchiOBHm_Chr5g0019821
rosa_laevigata RLG00000007998 RLG00000020883 RLG00000020887 RLG00000020922 RLG00000029052 RLG00000032473 RLG00000032474 RLG00000032477 RLG00000032478
rosa_multiflora Rmu_co8231441.1_g000001 Rmu_co8352639.1_g000001 Rmu_co8510723.1_g000001 Rmu_sc0000344.1_g000022 Rmu_sc0000344.1_g000023 Rmu_sc0001145.1_g000015 Rmu_sc0001145.1_g000016 Rmu_sc0001211.1_g000087 Rmu_sc0001319.1_g000003 Rmu_sc0008321.1_g000001 Rmu_sc0011512.1_g000007 Rmu_sc0011922.1_g000003 Rmu_sc0011922.1_g000007 Rmu_ssc0000155.1_g000002 Rmu_ssc0000155.1_g000004
rosa_roxburghii Rroxscaffold_1G00058320 Rroxscaffold_1G00058340 Rroxscaffold_2G00092930 Rroxscaffold_2G00093240 Rroxscaffold_2G00093270 Rroxscaffold_4G00311560 Rroxscaffold_4G00311590 Rroxscaffold_5G00360130
rosa_rugosa Rorug01G0160700.1 Rorug02G0451400 Rorug02G0454400 Rorug02G0454400 Rorug02G0454500 Rorug02G0454600 Rorug05G0054100 Rorug05G0054200 Rorug05G0054300
rosa_samantha Rh1AG175400 Rh1BG143700 Rh1BG143800 Rh1CG163400 Rh1DG175300 Rh1DG175400 Rh1DG175500 Rh2AG518200 Rh2AG518300 Rh2BG529400 Rh2BG532700 Rh2BG533200 Rh2CG502900 Rh2CG503000 Rh2DG538500 Rh2DG538600 Rh2DG541600 Rh2DG542000 Rh4BG200000 Rh4BG200100 Rh5AG144500 Rh5AG144600 Rh5AG366400 Rh5BG143500 Rh5BG143700 Rh5CG155000 Rh5CG155300 Rh5DG143500 Rh7BG257300 Rh7BG257400 Rh7BG257500
rosa_wichuraiana Rw1G014680 Rw2G042670 Rw2G042900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 441
AciI CCGC 6 cut(s) 8, 102, 131, 164, 197, 281
AclWI GGATC 2 cut(s) 287, 300
AcsI RAATTY 2 cut(s) 426, 651
AcuI CTGAAG 1 cut(s) 225
AfaI GTAC 1 cut(s) 408
AfiI CCNNNNNNNGG 3 cut(s) 108, 519, 520
AflIII ACRYGT 1 cut(s) 256
AgsI TTSAA 3 cut(s) 345, 541, 650
AhlI ACTAGT 1 cut(s) 607
AloI GAACNNNNNNTCC 2 cut(s) 284, 316
AluBI AGCT 1 cut(s) 371
AluI AGCT 1 cut(s) 371
Alw26I GTCTC 2 cut(s) 289, 320
AlwI GGATC 2 cut(s) 287, 300
AlwNI CAGNNNCTG 1 cut(s) 700
AoxI GGCC 1 cut(s) 642
ApoI RAATTY 2 cut(s) 426, 651
AspS9I GGNCC 2 cut(s) 462, 549
AvaII GGWCC 2 cut(s) 462, 549
BamHI GGATCC 1 cut(s) 292
BbsI GAAGAC 2 cut(s) 370, 525
BccI CCATC 1 cut(s) 592
BcoDI GTCTC 2 cut(s) 289, 320
BcuI ACTAGT 1 cut(s) 607
BfaI CTAG 1 cut(s) 608
BfmI CTRYAG 1 cut(s) 366
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
BmcAI AGTACT 1 cut(s) 408
Bme18I GGWCC 2 cut(s) 462, 549
BmgT120I GGNCC 2 cut(s) 462, 549
BmiI GGNNCC 3 cut(s) 12, 294, 631
BmsI GCATC 1 cut(s) 385
BpiI GAAGAC 2 cut(s) 370, 525
BpmI CTGGAG 1 cut(s) 677
BsaI GGTCTC 1 cut(s) 289
BsaJI CCNNGG 1 cut(s) 704
Bsc4I CCNNNNNNNGG 3 cut(s) 108, 519, 520
Bse1I ACTGG 4 cut(s) 33, 294, 464, 694
BseDI CCNNGG 1 cut(s) 704
BseGI GGATG 2 cut(s) 234, 400
BseLI CCNNNNNNNGG 3 cut(s) 108, 519, 520
BseNI ACTGG 4 cut(s) 33, 294, 464, 694
Bsh1285I CGRYCG 1 cut(s) 386
BshFI GGCC 1 cut(s) 644
BsiEI CGRYCG 1 cut(s) 386
BslI CCNNNNNNNGG 3 cut(s) 108, 519, 520
BsmAI GTCTC 2 cut(s) 289, 320
BsnI GGCC 1 cut(s) 644
Bso31I GGTCTC 1 cut(s) 289
Bsp143I GATC 4 cut(s) 292, 383, 421, 433
BspACI CCGC 6 cut(s) 8, 102, 131, 164, 197, 281
BspANI GGCC 1 cut(s) 644
BspLI GGNNCC 3 cut(s) 12, 294, 631
BspPI GGATC 2 cut(s) 287, 300
BspTNI GGTCTC 1 cut(s) 289
BsrI ACTGG 4 cut(s) 33, 294, 464, 694
BssECI CCNNGG 1 cut(s) 704
BssMI GATC 4 cut(s) 292, 383, 421, 433
BssT1I CCWWGG 1 cut(s) 704
Bst6I CTCTTC 1 cut(s) 539
BstC8I GCNNGC 2 cut(s) 72, 184
BstF5I GGATG 2 cut(s) 234, 400
BstKTI GATC 4 cut(s) 295, 386, 424, 436
BstMAI GTCTC 2 cut(s) 289, 320
BstMBI GATC 4 cut(s) 292, 383, 421, 433
BstMCI CGRYCG 1 cut(s) 386
BstMWI GCNNNNNNNGC 2 cut(s) 101, 221
BstNSI RCATGY 5 cut(s) 51, 78, 120, 186, 260
BstSFI CTRYAG 1 cut(s) 366
BstV2I GAAGAC 2 cut(s) 370, 525
BstX2I RGATCY 1 cut(s) 292
BstYI RGATCY 1 cut(s) 292
BsuRI GGCC 1 cut(s) 644
BtsCI GGATG 2 cut(s) 234, 400
BtsIMutI CAGTG 3 cut(s) 26, 47, 287
Cac8I GCNNGC 2 cut(s) 72, 184
CaiI CAGNNNCTG 1 cut(s) 700
Cfr13I GGNCC 2 cut(s) 462, 549
Csp6I GTAC 1 cut(s) 407
CviAII CATG 8 cut(s) 48, 75, 117, 150, 183, 216, 257, 273
CviJI RGCY 7 cut(s) 11, 224, 371, 602, 615, 632, 644
CviKI_1 RGCY 7 cut(s) 11, 224, 371, 602, 615, 632, 644
CviQI GTAC 1 cut(s) 407
DpnI GATC 4 cut(s) 294, 385, 423, 435
DpnII GATC 4 cut(s) 292, 383, 421, 433
Eam1104I CTCTTC 1 cut(s) 539
EarI CTCTTC 1 cut(s) 539
Eco130I CCWWGG 1 cut(s) 704
Eco31I GGTCTC 1 cut(s) 289
Eco47I GGWCC 2 cut(s) 462, 549
Eco57I CTGAAG 1 cut(s) 225
EcoO109I RGGNCCY 1 cut(s) 549
EcoT14I CCWWGG 1 cut(s) 704
ErhI CCWWGG 1 cut(s) 704
FaeI CATG 8 cut(s) 51, 78, 120, 153, 186, 219, 260, 276
FalI AAGNNNNNCTT 2 cut(s) 536, 568
FatI CATG 8 cut(s) 47, 74, 116, 149, 182, 215, 256, 272
FblI GTMKAC 1 cut(s) 441
Fnu4HI GCNGC 1 cut(s) 9
FokI GGATG 2 cut(s) 221, 407
Fsp4HI GCNGC 1 cut(s) 9
FspBI CTAG 1 cut(s) 608
GluI GCNGC 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 677
HaeIII GGCC 1 cut(s) 644
Hin1II CATG 8 cut(s) 51, 78, 120, 153, 186, 219, 260, 276
HincII GTYRAC 2 cut(s) 442, 568
HindII GTYRAC 2 cut(s) 442, 568
HinfI GANTC 7 cut(s) 443, 467, 473, 485, 491, 509, 635
HpaI GTTAAC 1 cut(s) 568
Hpy166II GTNNAC 3 cut(s) 53, 442, 568
Hpy188I TCNGA 7 cut(s) 383, 448, 466, 472, 484, 490, 508
Hpy188III TCNNGA 1 cut(s) 230
Hpy8I GTNNAC 3 cut(s) 53, 442, 568
Hpy99I CGWCG 1 cut(s) 326
HpyAV CCTTC 3 cut(s) 214, 249, 562
HpyCH4IV ACGT 1 cut(s) 678
HpyCH4V TGCA 7 cut(s) 35, 62, 95, 137, 170, 186, 203
HpyF10VI GCNNNNNNNGC 2 cut(s) 101, 221
HpySE526I ACGT 1 cut(s) 678
Hsp92II CATG 8 cut(s) 51, 78, 120, 153, 186, 219, 260, 276
KspAI GTTAAC 1 cut(s) 568
Kzo9I GATC 4 cut(s) 292, 383, 421, 433
LmnI GCTCC 3 cut(s) 16, 629, 678
LpnPI CCDG 4 cut(s) 14, 275, 445, 504
LweI GCATC 1 cut(s) 385
MaeI CTAG 1 cut(s) 608
MaeII ACGT 1 cut(s) 678
MalI GATC 4 cut(s) 294, 385, 423, 435
MboI GATC 4 cut(s) 292, 383, 421, 433
MboII GAAGA 5 cut(s) 370, 525, 553, 556, 575
MfeI CAATTG 5 cut(s) 57, 84, 126, 159, 192
MflI RGATCY 1 cut(s) 292
MlyI GAGTC 7 cut(s) 437, 461, 467, 479, 485, 503, 629
MmeI TCCRAC 6 cut(s) 489, 501, 507, 513, 519, 531
MnlI CCTC 3 cut(s) 306, 540, 701
MseI TTAA 3 cut(s) 417, 567, 660
MunI CAATTG 5 cut(s) 57, 84, 126, 159, 192
MwoI GCNNNNNNNGC 2 cut(s) 101, 221
NdeII GATC 4 cut(s) 292, 383, 421, 433
NlaIII CATG 8 cut(s) 51, 78, 120, 153, 186, 219, 260, 276
NlaIV GGNNCC 3 cut(s) 12, 294, 631
NspI RCATGY 5 cut(s) 51, 78, 120, 186, 260
PaeI GCATGC 1 cut(s) 186
PciI ACATGT 1 cut(s) 256
PkrI GCNGC 1 cut(s) 10
Ple19I CGATCG 1 cut(s) 386
PleI GAGTC 7 cut(s) 437, 461, 467, 479, 485, 503, 629
PpsI GAGTC 7 cut(s) 437, 461, 467, 479, 485, 503, 629
PpuMI RGGWCCY 1 cut(s) 549
PscI ACATGT 1 cut(s) 256
Psp5II RGGWCCY 1 cut(s) 549
PspN4I GGNNCC 3 cut(s) 12, 294, 631
PspPI GGNCC 2 cut(s) 462, 549
PspPPI RGGWCCY 1 cut(s) 549
PstNI CAGNNNCTG 1 cut(s) 700
PsuI RGATCY 1 cut(s) 292
PvuI CGATCG 1 cut(s) 386
RsaI GTAC 1 cut(s) 408
RsaNI GTAC 1 cut(s) 407
SalI GTCGAC 1 cut(s) 440
SaqAI TTAA 3 cut(s) 417, 567, 660
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 4 cut(s) 292, 383, 421, 433
Sau96I GGNCC 2 cut(s) 462, 549
ScaI AGTACT 1 cut(s) 408
SchI GAGTC 7 cut(s) 437, 461, 467, 479, 485, 503, 629
SetI ASST 4 cut(s) 373, 503, 554, 681
SfaNI GCATC 1 cut(s) 385
SfcI CTRYAG 1 cut(s) 366
SinI GGWCC 2 cut(s) 462, 549
SpeI ACTAGT 1 cut(s) 607
SphI GCATGC 1 cut(s) 186
SsiI CCGC 6 cut(s) 8, 102, 131, 164, 197, 281
SspI AATATT 1 cut(s) 18
SspMI CTAG 1 cut(s) 608
StyI CCWWGG 1 cut(s) 704
TaiI ACGT 1 cut(s) 681
TaqI TCGA 2 cut(s) 321, 441
TatI WGTACW 1 cut(s) 406
TauI GCSGC 1 cut(s) 11
Tru1I TTAA 3 cut(s) 417, 567, 660
Tru9I TTAA 3 cut(s) 417, 567, 660
TscAI CASTG 3 cut(s) 33, 47, 294
TspDTI ATGAA 1 cut(s) 525
TspGWI ACGGA 1 cut(s) 407
TspRI CASTG 3 cut(s) 33, 47, 294
VpaK11BI GGWCC 2 cut(s) 462, 549
XapI RAATTY 2 cut(s) 426, 651
XceI RCATGY 5 cut(s) 51, 78, 120, 186, 260
XcmI CCANNNNNNNNNTGG 2 cut(s) 63, 595
XmiI GTMKAC 1 cut(s) 441
XspI CTAG 1 cut(s) 608
ZrmI AGTACT 1 cut(s) 408
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.