Rmu_ssc0000155.1_g000002

Cyclic nucleotide-gated ion channel 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000155.1
OG0000491
Physical Location & Seq
Reverse (-)
11328 .. 11990
663 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000155.1_g000002.1.cds

Sequence Viewer

Length: 663 bp
atgatctgcaaccatctcgagccagtggtctacaagaagaatagctatgttgttagagcgggagaaccactcagtatcatgatctttattctgcgaggcggaattatcttaactgacaagactagcagcaatgccacaacaagaaattcctctgagatcactgagacatgtgatgaaaatgttattgagatagagagttattatggagaacaacttctgagatgggcatcacccaacaacatttcttcatctgacaatcccgtcatctcaactagagatgtcaaatgtcaaacaaaagtggaagccttgattctcaaggccgaggacttggaaagtgtagcctccaaatgcggatcgcagtggaatttcaacaattgtatgaattctcagcaattggttgatgatggtagagatcgtgtggctaatacagcacttacgtccactattgaggagactatccgtcttcatcagggtcatgacatgcttctcgagcagctggttctaattcgagaaaccatgttccagtttcgcaatgatatggcacgaaggctagatgatcaaggacagagactagataatcagggacggaggttagatgagatggctgcattcttagctagattgggatatacgagcacatctcctcccgctgcagcaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

220

Amino Acids

24.73

Weight (kDa)

5.07

Isoelectric Point (pI)

53.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000491)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g12100 FvH4_3g12110 FvH4_3g12111 FvH4_3g12120 FvH4_3g12120 FvH4_3g28952 FvH4_6g40660 FvH4_6g40661 FvH4_6g40960
rosa_chinensis RchiOBHm_Chr1g0340941 RchiOBHm_Chr2g0156041 RchiOBHm_Chr2g0156591 RchiOBHm_Chr5g0019791 RchiOBHm_Chr5g0019821
rosa_laevigata RLG00000007998 RLG00000020883 RLG00000020887 RLG00000020922 RLG00000029052 RLG00000032473 RLG00000032474 RLG00000032477 RLG00000032478
rosa_multiflora Rmu_co8231441.1_g000001 Rmu_co8352639.1_g000001 Rmu_co8510723.1_g000001 Rmu_sc0000344.1_g000022 Rmu_sc0000344.1_g000023 Rmu_sc0001145.1_g000015 Rmu_sc0001145.1_g000016 Rmu_sc0001211.1_g000087 Rmu_sc0001319.1_g000003 Rmu_sc0008321.1_g000001 Rmu_sc0011512.1_g000007 Rmu_sc0011922.1_g000003 Rmu_sc0011922.1_g000007 Rmu_ssc0000155.1_g000002 Rmu_ssc0000155.1_g000004
rosa_roxburghii Rroxscaffold_1G00058320 Rroxscaffold_1G00058340 Rroxscaffold_2G00092930 Rroxscaffold_2G00093240 Rroxscaffold_2G00093270 Rroxscaffold_4G00311560 Rroxscaffold_4G00311590 Rroxscaffold_5G00360130
rosa_rugosa Rorug01G0160700.1 Rorug02G0451400 Rorug02G0454400 Rorug02G0454400 Rorug02G0454500 Rorug02G0454600 Rorug05G0054100 Rorug05G0054200 Rorug05G0054300
rosa_samantha Rh1AG175400 Rh1BG143700 Rh1BG143800 Rh1CG163400 Rh1DG175300 Rh1DG175400 Rh1DG175500 Rh2AG518200 Rh2AG518300 Rh2BG529400 Rh2BG532700 Rh2BG533200 Rh2CG502900 Rh2CG503000 Rh2DG538500 Rh2DG538600 Rh2DG541600 Rh2DG542000 Rh4BG200000 Rh4BG200100 Rh5AG144500 Rh5AG144600 Rh5AG366400 Rh5BG143500 Rh5BG143700 Rh5CG155000 Rh5CG155300 Rh5DG143500 Rh7BG257300 Rh7BG257400 Rh7BG257500
rosa_wichuraiana Rw1G014680 Rw2G042670 Rw2G042900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 260
AccBSI CCGCTC 1 cut(s) 59
AccI GTMKAC 1 cut(s) 30
AciI CCGC 4 cut(s) 59, 99, 351, 648
AclWI GGATC 1 cut(s) 361
AcsI RAATTY 3 cut(s) 145, 364, 382
AflIII ACRYGT 1 cut(s) 167
AgsI TTSAA 1 cut(s) 370
AhdI GACNNNNNGTC 1 cut(s) 459
AluBI AGCT 3 cut(s) 45, 496, 617
AluI AGCT 3 cut(s) 45, 496, 617
Alw21I GWGCWC 1 cut(s) 638
Alw26I GTCTC 3 cut(s) 158, 446, 562
AlwI GGATC 1 cut(s) 361
Ama87I CYCGRG 2 cut(s) 17, 488
AoxI GGCC 1 cut(s) 318
ApeKI GCWGC 5 cut(s) 126, 493, 605, 650, 653
ApoI RAATTY 3 cut(s) 145, 364, 382
Asp700I GAANNNNTTC 1 cut(s) 213
AsuHPI GGTGA 1 cut(s) 222
AvaI CYCGRG 2 cut(s) 17, 488
BbsI GAAGAC 1 cut(s) 455
Bbv12I GWGCWC 1 cut(s) 638
BbvI GCAGC 4 cut(s) 138, 505, 592, 637
BccI CCATC 4 cut(s) 21, 216, 398, 595
BcgI CGANNNNNNTGC 1 cut(s) 32
BclI TGATCA 1 cut(s) 556
BcoDI GTCTC 3 cut(s) 158, 446, 562
BfaI CTAG 5 cut(s) 123, 273, 551, 572, 618
BfmI CTRYAG 1 cut(s) 651
BisI GCNGC 5 cut(s) 127, 494, 606, 651, 654
BlsI GCNGC 5 cut(s) 128, 495, 607, 652, 655
BmeRI GACNNNNNGTC 1 cut(s) 459
BmeT110I CYCGRG 2 cut(s) 17, 488
BmsI GCATC 1 cut(s) 236
BpiI GAAGAC 1 cut(s) 455
BplI GAGNNNNNCTC 4 cut(s) 54, 86, 625, 657
BpuEI CTTGAG 1 cut(s) 299
BsaBI GATNNNNATC 1 cut(s) 226
BsaJI CCNNGG 1 cut(s) 321
BsaXI ACNNNNNCTCC 2 cut(s) 628, 658
Bse1I ACTGG 2 cut(s) 23, 523
Bse3DI GCAATG 2 cut(s) 136, 538
Bse8I GATNNNNATC 1 cut(s) 226
BseDI CCNNGG 1 cut(s) 321
BseJI GATNNNNATC 1 cut(s) 226
BseMI GCAATG 2 cut(s) 136, 538
BseMII CTCAG 5 cut(s) 85, 144, 153, 209, 401
BseNI ACTGG 2 cut(s) 23, 523
BseRI GAGGAG 2 cut(s) 464, 633
BseXI GCAGC 4 cut(s) 138, 505, 592, 637
BshFI GGCC 1 cut(s) 320
BsiHKAI GWGCWC 1 cut(s) 638
BsiHKCI CYCGRG 2 cut(s) 17, 488
BslFI GGGAC 1 cut(s) 597
BsmAI GTCTC 3 cut(s) 158, 446, 562
BsmFI GGGAC 1 cut(s) 597
BsmI GAATGC 1 cut(s) 608
BsnI GGCC 1 cut(s) 320
BsoBI CYCGRG 2 cut(s) 17, 488
Bsp1286I GDGCHC 1 cut(s) 638
Bsp143I GATC 6 cut(s) 3, 81, 156, 353, 412, 556
BspACI CCGC 4 cut(s) 59, 99, 351, 648
BspANI GGCC 1 cut(s) 320
BspCNI CTCAG 5 cut(s) 84, 145, 154, 210, 400
BspHI TCATGA 2 cut(s) 78, 475
BspMAI CTGCAG 1 cut(s) 655
BspPI GGATC 1 cut(s) 361
BsrBI CCGCTC 1 cut(s) 59
BsrDI GCAATG 2 cut(s) 136, 538
BsrI ACTGG 2 cut(s) 23, 523
BssECI CCNNGG 1 cut(s) 321
BssMI GATC 6 cut(s) 3, 81, 156, 353, 412, 556
BstDEI CTNAG 6 cut(s) 71, 153, 162, 218, 387, 613
BstKTI GATC 6 cut(s) 6, 84, 159, 356, 415, 559
BstMAI GTCTC 3 cut(s) 158, 446, 562
BstMBI GATC 6 cut(s) 3, 81, 156, 353, 412, 556
BstMWI GCNNNNNNNGC 3 cut(s) 428, 490, 614
BstNSI RCATGY 2 cut(s) 171, 484
BstSFI CTRYAG 1 cut(s) 651
BstV1I GCAGC 4 cut(s) 138, 505, 592, 637
BstV2I GAAGAC 1 cut(s) 455
BsuRI GGCC 1 cut(s) 320
BtsI GCAGTG 1 cut(s) 365
BtsIMutI CAGTG 3 cut(s) 30, 159, 365
CciI TCATGA 2 cut(s) 78, 475
CviAII CATG 5 cut(s) 79, 168, 476, 481, 517
DdeI CTNAG 6 cut(s) 71, 153, 162, 218, 387, 613
DpnI GATC 6 cut(s) 5, 83, 158, 355, 414, 558
DpnII GATC 6 cut(s) 3, 81, 156, 353, 412, 556
DrdI GACNNNNNNGTC 1 cut(s) 260
DriI GACNNNNNGTC 1 cut(s) 459
DseDI GACNNNNNNGTC 1 cut(s) 260
Eam1105I GACNNNNNGTC 1 cut(s) 459
EciI GGCGGA 1 cut(s) 114
Eco88I CYCGRG 2 cut(s) 17, 488
EcoRI GAATTC 1 cut(s) 382
FaeI CATG 5 cut(s) 82, 171, 479, 484, 520
FaqI GGGAC 1 cut(s) 597
FatI CATG 5 cut(s) 78, 167, 475, 480, 516
FauI CCCGC 2 cut(s) 52, 655
FbaI TGATCA 1 cut(s) 556
FblI GTMKAC 1 cut(s) 30
Fnu4HI GCNGC 5 cut(s) 127, 494, 606, 651, 654
Fsp4HI GCNGC 5 cut(s) 127, 494, 606, 651, 654
FspBI CTAG 5 cut(s) 123, 273, 551, 572, 618
GluI GCNGC 5 cut(s) 127, 494, 606, 651, 654
HaeIII GGCC 1 cut(s) 320
Hin1II CATG 5 cut(s) 82, 171, 479, 484, 520
HinfI GANTC 1 cut(s) 310
HphI GGTGA 1 cut(s) 222
Hpy166II GTNNAC 2 cut(s) 31, 441
Hpy188I TCNGA 3 cut(s) 154, 219, 253
Hpy188III TCNNGA 5 cut(s) 17, 79, 476, 488, 509
Hpy8I GTNNAC 2 cut(s) 31, 441
HpyAV CCTTC 1 cut(s) 540
HpyCH4IV ACGT 1 cut(s) 437
HpyCH4V TGCA 3 cut(s) 9, 608, 653
HpyF10VI GCNNNNNNNGC 3 cut(s) 428, 490, 614
HpyF3I CTNAG 6 cut(s) 71, 153, 162, 218, 387, 613
HpySE526I ACGT 1 cut(s) 437
Hsp92II CATG 5 cut(s) 82, 171, 479, 484, 520
Ksp22I TGATCA 1 cut(s) 556
Kzo9I GATC 6 cut(s) 3, 81, 156, 353, 412, 556
LpnPI CCDG 5 cut(s) 36, 455, 482, 536, 566
Lsp1109I GCAGC 4 cut(s) 138, 505, 592, 637
LweI GCATC 1 cut(s) 236
MaeI CTAG 5 cut(s) 123, 273, 551, 572, 618
MaeII ACGT 1 cut(s) 437
MalI GATC 6 cut(s) 5, 83, 158, 355, 414, 558
MbiI CCGCTC 1 cut(s) 59
MboI GATC 6 cut(s) 3, 81, 156, 353, 412, 556
MboII GAAGA 3 cut(s) 49, 237, 455
MfeI CAATTG 2 cut(s) 373, 392
MhlI GDGCHC 1 cut(s) 638
MluCI AATT 7 cut(s) 102, 145, 364, 373, 382, 392, 504
MnlI CCTC 7 cut(s) 89, 160, 316, 352, 442, 582, 654
MroXI GAANNNNTTC 1 cut(s) 213
MseI TTAA 1 cut(s) 110
MspA1I CMGCKG 2 cut(s) 496, 650
MunI CAATTG 2 cut(s) 373, 392
Mva1269I GAATGC 1 cut(s) 608
MwoI GCNNNNNNNGC 3 cut(s) 428, 490, 614
NdeII GATC 6 cut(s) 3, 81, 156, 353, 412, 556
NlaIII CATG 5 cut(s) 82, 171, 479, 484, 520
NmeAIII GCCGAG 1 cut(s) 346
NspI RCATGY 2 cut(s) 171, 484
PaeR7I CTCGAG 2 cut(s) 17, 488
PagI TCATGA 2 cut(s) 78, 475
PciI ACATGT 1 cut(s) 167
PctI GAATGC 1 cut(s) 608
PdmI GAANNNNTTC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 310
PkrI GCNGC 5 cut(s) 128, 495, 607, 652, 655
PscI ACATGT 1 cut(s) 167
PstI CTGCAG 1 cut(s) 655
PvuII CAGCTG 1 cut(s) 496
SaqAI TTAA 1 cut(s) 110
SatI GCNGC 5 cut(s) 127, 494, 606, 651, 654
Sau3AI GATC 6 cut(s) 3, 81, 156, 353, 412, 556
SduI GDGCHC 1 cut(s) 638
SetI ASST 6 cut(s) 47, 440, 498, 593, 619, 661
SfaNI GCATC 1 cut(s) 236
SfcI CTRYAG 1 cut(s) 651
Sfr274I CTCGAG 2 cut(s) 17, 488
SlaI CTCGAG 2 cut(s) 17, 488
SmlI CTYRAG 3 cut(s) 17, 314, 488
SmoI CTYRAG 3 cut(s) 17, 314, 488
Sse9I AATT 7 cut(s) 102, 145, 364, 373, 382, 392, 504
SsiI CCGC 4 cut(s) 59, 99, 351, 648
SspMI CTAG 5 cut(s) 123, 273, 551, 572, 618
TaiI ACGT 1 cut(s) 440
TaqI TCGA 3 cut(s) 18, 489, 508
TasI AATT 7 cut(s) 102, 145, 364, 373, 382, 392, 504
TfiI GAWTC 1 cut(s) 310
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TscAI CASTG 3 cut(s) 30, 166, 365
TseI GCWGC 5 cut(s) 126, 493, 605, 650, 653
TspDTI ATGAA 4 cut(s) 189, 237, 395, 455
TspGWI ACGGA 2 cut(s) 449, 601
TspRI CASTG 3 cut(s) 30, 166, 365
XapI RAATTY 3 cut(s) 145, 364, 382
XceI RCATGY 2 cut(s) 171, 484
XhoI CTCGAG 2 cut(s) 17, 488
XmiI GTMKAC 1 cut(s) 30
XmnI GAANNNNTTC 1 cut(s) 213
XspI CTAG 5 cut(s) 123, 273, 551, 572, 618
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.