Rmu_sc0000645.1_g000011
WRKY Family

WRKY Transcription Factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000645.1
Physical Location & Seq
Reverse (-)
35452 .. 36411
960 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000645.1_g000011.1.cds

Sequence Viewer

Length: 960 bp
atgccggccaagctgatcggaggaccgctgtataatcagctttttgatggtgttaagacagcaacaggcaggagtacaaagttcacctccctcctcgaagatctcaaattcacgctagtctctctgcaaccacgaatcaatcgacagagaggagatcagcacgatgcggaaattcatcatctccttccaaatgaggaaatacaagatcttgagcgacagatggaggagggagtgaagctggttgccaagctatcaagtgttggaatatggaactaccactgcatgaagagtaactactccgaccaactagctcaattggataggtctctcagaaaaatgttatacatactcaagctgcaggaagaaagagatataatggagctcttgcttgttgctaggacaatacgcgacagacagaatgttttggagagaagactgtgtggtttactcaaagtgcagcaggagaaaaccgatggcaatggtcacgtcggcagcggaggaggaggaggggctggtcgggagctggagcatgtattttgccgtctacttgaatcccttgttttggaagtttatgtacaattgaatgggaaaacgaggttcagtcccgtcttggcagatttgaaatcgacggttaggtccttccaaccactcatggaagaaatatcagattataacaagttattgcatctaccgaaggaggaactagacaatttgaggaagcaactggagaaaggtatcgagctggtcgacaagtgctccaaggttcctcaaggggcgagctacaaaaagtatgaatacgccgacgaactacttgagttggatgactatcttcagagattgttgtgtatgatgagggagcaggtagcaaaggatttgaaggagaccttggtttctgtaagcaacatggagatgatgttaacgcgaattgaagagggtagtagtggtctggcacaaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

319

Amino Acids

36.46

Weight (kDa)

6.05

Isoelectric Point (pI)

44.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000408)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g11090 FvH4_5g11120 FvH4_5g11130 FvH4_5g11160 FvH4_5g11200 FvH4_5g11201 FvH4_5g11220 FvH4_5g11230 FvH4_5g11231 FvH4_5g11250
malus_domestica MD02G1021700.v1.1 MD02G1022000.v1.1 MD06G1115400.v1.1 MD06G1115800.v1.1 MD06G1116100.v1.1 MD15G1278700.v1.1
prunus_persica Prupe.5G127700_v2.0.a1 Prupe.5G127800_v2.0.a1 Prupe.5G127900_v2.0.a1 Prupe.7G138400_v2.0.a1 Prupe.7G138400_v2.0.a1 Prupe.7G138400_v2.0.a1
pyrus_communis pycom06g10800 pycom06g10840 pycom14g10990 pycom15g24080 pycom15g24110 pycom15g24120
rosa_chinensis RchiOBHm_Chr2g0104561 RchiOBHm_Chr7g0186621 RchiOBHm_Chr7g0186631 RchiOBHm_Chr7g0186691
rosa_laevigata RLG00000002334 RLG00000004825 RLG00000004827 RLG00000004828 RLG00000014202
rosa_multiflora Rmu_sc0000645.1_g000001 Rmu_sc0000645.1_g000011 Rmu_sc0000645.1_g000016 Rmu_sc0001301.1_g000003 Rmu_sc0001852.1_g000020 Rmu_sc0002316.1_g000047 Rmu_sc0003419.1_g000031 Rmu_sc0003825.1_g000016 Rmu_sc0005784.1_g000004 Rmu_sc0005784.1_g000013 Rmu_sc0005784.1_g000014 Rmu_sc0007722.1_g000010 Rmu_sc0007722.1_g000018
rosa_roxburghii Rroxscaffold_3G00240400 Rroxscaffold_3G00267900 Rroxscaffold_3G00267910 Rroxscaffold_3G00267940 Rroxscaffold_3G00267990 Rroxscaffold_3G00268000
rosa_rugosa Rorug02G0116000 Rorug02G0120800 Rorug02G0120900 Rorug06G0475500 Rorug06G0475600 Rorug06G0475600 Rorug06G0475700
rosa_samantha Rh2AG164300 Rh2AG171300 Rh2AG173100 Rh2BG171500 Rh2BG178600 Rh2BG180800 Rh2DG169600 Rh2DG177300 Rh2DG179300 Rh7AG065000 Rh7AG065200 Rh7AG065300 Rh7AG321500 Rh7AG321700 Rh7AG322300 Rh7AG322400 Rh7BG081200 Rh7BG081300 Rh7BG313300 Rh7CG082400 Rh7CG082600 Rh7CG338000 Rh7CG338200 Rh7CG339000 Rh7CG339100 Rh7DG083400 Rh7DG083500 Rh7DG083700 Rh7DG319500 Rh7DG319600
rosa_wichuraiana Rw0G013250 Rw7G006930 Rw7G006940 Rw7G007150 Rw7G007180 Rw7G026920 Rw7G027300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 672
AasI GACNNNNNNGTC 1 cut(s) 634
Acc36I ACCTGC 1 cut(s) 850
AccI GTMKAC 2 cut(s) 544, 747
AccII CGCG 2 cut(s) 408, 922
AciI CCGC 3 cut(s) 26, 167, 495
AcoI YGGCCR 1 cut(s) 6
AcsI RAATTY 2 cut(s) 107, 171
AcuI CTGAAG 1 cut(s) 815
AfaI GTAC 2 cut(s) 76, 576
AfiI CCNNNNNNNGG 1 cut(s) 562
AgsI TTSAA 5 cut(s) 551, 583, 622, 877, 929
AjiI CACGTC 1 cut(s) 487
AjuI GAANNNNNNNTTGG 2 cut(s) 869, 901
Alw21I GWGCWC 2 cut(s) 384, 758
Alw26I GTCTC 3 cut(s) 124, 330, 875
AoxI GGCC 1 cut(s) 6
ApeKI GCWGC 3 cut(s) 355, 457, 492
ApoI RAATTY 2 cut(s) 107, 171
AspS9I GGNCC 2 cut(s) 23, 636
AsuHPI GGTGA 1 cut(s) 76
AvaII GGWCC 2 cut(s) 23, 636
BanII GRGCYC 1 cut(s) 384
BarI GAAGNNNNNNTAC 4 cut(s) 278, 310, 558, 590
BbsI GAAGAC 1 cut(s) 439
Bbv12I GWGCWC 2 cut(s) 384, 758
BbvI GCAGC 3 cut(s) 342, 469, 504
BccI CCATC 3 cut(s) 41, 214, 467
BceAI ACGGC 1 cut(s) 525
BcoDI GTCTC 3 cut(s) 124, 330, 875
BfaI CTAG 4 cut(s) 116, 308, 396, 704
BfmI CTRYAG 1 cut(s) 356
BfuAI ACCTGC 1 cut(s) 850
BglII AGATCT 2 cut(s) 100, 205
BisI GCNGC 3 cut(s) 356, 458, 493
BlsI GCNGC 3 cut(s) 357, 459, 494
Bme18I GGWCC 2 cut(s) 23, 636
BmgBI CACGTC 1 cut(s) 487
BmgT120I GGNCC 2 cut(s) 23, 636
BmiI GGNNCC 1 cut(s) 765
BmsI GCATC 2 cut(s) 154, 694
BpiI GAAGAC 1 cut(s) 439
BpmI CTGGAG 2 cut(s) 545, 746
BpuEI CTTGAG 4 cut(s) 230, 335, 753, 833
BsaBI GATNNNNATC 1 cut(s) 825
BsaI GGTCTC 2 cut(s) 330, 875
BsaJI CCNNGG 2 cut(s) 759, 885
BsaXI ACNNNNNCTCC 4 cut(s) 740, 770, 899, 929
Bsc4I CCNNNNNNNGG 1 cut(s) 562
Bse118I RCCGGY 1 cut(s) 4
Bse1I ACTGG 1 cut(s) 729
Bse3DI GCAATG 1 cut(s) 484
Bse8I GATNNNNATC 1 cut(s) 825
BseDI CCNNGG 2 cut(s) 759, 885
BseGI GGATG 1 cut(s) 826
BseJI GATNNNNATC 1 cut(s) 825
BseLI CCNNNNNNNGG 1 cut(s) 562
BseMI GCAATG 1 cut(s) 484
BseMII CTCAG 1 cut(s) 343
BseNI ACTGG 1 cut(s) 729
BseRI GAGGAG 6 cut(s) 83, 165, 239, 513, 516, 519
BseXI GCAGC 3 cut(s) 342, 469, 504
BsgI GTGCAG 1 cut(s) 476
Bsh1236I CGCG 2 cut(s) 408, 922
BshFI GGCC 1 cut(s) 8
BsiHKAI GWGCWC 2 cut(s) 384, 758
BsiSI CCGG 1 cut(s) 5
BslFI GGGAC 1 cut(s) 588
BslI CCNNNNNNNGG 1 cut(s) 562
BsmAI GTCTC 3 cut(s) 124, 330, 875
BsmFI GGGAC 1 cut(s) 588
BsnI GGCC 1 cut(s) 8
Bso31I GGTCTC 2 cut(s) 330, 875
Bsp1286I GDGCHC 2 cut(s) 384, 758
Bsp1407I TGTACA 1 cut(s) 574
Bsp143I GATC 4 cut(s) 15, 100, 154, 205
BspACI CCGC 3 cut(s) 26, 167, 495
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 342
BspFNI CGCG 2 cut(s) 408, 922
BspLI GGNNCC 1 cut(s) 765
BspMAI CTGCAG 1 cut(s) 360
BspMI ACCTGC 1 cut(s) 850
BspTNI GGTCTC 2 cut(s) 330, 875
BsrDI GCAATG 1 cut(s) 484
BsrFI RCCGGY 1 cut(s) 4
BsrGI TGTACA 1 cut(s) 574
BsrI ACTGG 1 cut(s) 729
BssAI RCCGGY 1 cut(s) 4
BssECI CCNNGG 2 cut(s) 759, 885
BssMI GATC 4 cut(s) 15, 100, 154, 205
BssT1I CCWWGG 2 cut(s) 759, 885
Bst4CI ACNGT 2 cut(s) 438, 631
Bst6I CTCTTC 2 cut(s) 281, 924
BstAUI TGTACA 1 cut(s) 574
BstC8I GCNNGC 2 cut(s) 6, 778
BstDEI CTNAG 1 cut(s) 329
BstF5I GGATG 1 cut(s) 826
BstFNI CGCG 2 cut(s) 408, 922
BstKTI GATC 4 cut(s) 18, 103, 157, 208
BstMAI GTCTC 3 cut(s) 124, 330, 875
BstMBI GATC 4 cut(s) 15, 100, 154, 205
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNSI RCATGY 1 cut(s) 533
BstSFI CTRYAG 1 cut(s) 356
BstUI CGCG 2 cut(s) 408, 922
BstV1I GCAGC 3 cut(s) 342, 469, 504
BstV2I GAAGAC 1 cut(s) 439
BstX2I RGATCY 2 cut(s) 100, 205
BstYI RGATCY 2 cut(s) 100, 205
BsuRI GGCC 1 cut(s) 8
BtrI CACGTC 1 cut(s) 487
BtsCI GGATG 1 cut(s) 826
BtsI GCAGTG 1 cut(s) 277
BtsIMutI CAGTG 1 cut(s) 277
BveI ACCTGC 1 cut(s) 850
Cac8I GCNNGC 2 cut(s) 6, 778
Cfr10I RCCGGY 1 cut(s) 4
Cfr13I GGNCC 2 cut(s) 23, 636
Csp6I GTAC 2 cut(s) 75, 575
CviAII CATG 4 cut(s) 283, 530, 652, 904
CviQI GTAC 2 cut(s) 75, 575
DdeI CTNAG 1 cut(s) 329
DpnI GATC 4 cut(s) 17, 102, 156, 207
DpnII GATC 4 cut(s) 15, 100, 154, 205
DrdI GACNNNNNNGTC 1 cut(s) 634
DseDI GACNNNNNNGTC 1 cut(s) 634
EaeI YGGCCR 1 cut(s) 6
Eam1104I CTCTTC 2 cut(s) 281, 924
EarI CTCTTC 2 cut(s) 281, 924
Ecl136II GAGCTC 1 cut(s) 382
Eco130I CCWWGG 2 cut(s) 759, 885
Eco24I GRGCYC 1 cut(s) 384
Eco31I GGTCTC 2 cut(s) 330, 875
Eco47I GGWCC 2 cut(s) 23, 636
Eco53kI GAGCTC 1 cut(s) 382
Eco57I CTGAAG 1 cut(s) 815
EcoICRI GAGCTC 1 cut(s) 382
EcoO109I RGGNCCY 1 cut(s) 636
EcoT14I CCWWGG 2 cut(s) 759, 885
EcoT38I GRGCYC 1 cut(s) 384
ErhI CCWWGG 2 cut(s) 759, 885
FaeI CATG 4 cut(s) 286, 533, 655, 907
FalI AAGNNNNNCTT 2 cut(s) 869, 901
FaqI GGGAC 1 cut(s) 588
FatI CATG 4 cut(s) 282, 529, 651, 903
FblI GTMKAC 2 cut(s) 544, 747
Fnu4HI GCNGC 3 cut(s) 356, 458, 493
FokI GGATG 1 cut(s) 833
FriOI GRGCYC 1 cut(s) 384
Fsp4HI GCNGC 3 cut(s) 356, 458, 493
FspBI CTAG 4 cut(s) 116, 308, 396, 704
GluI GCNGC 3 cut(s) 356, 458, 493
GsuI CTGGAG 2 cut(s) 545, 746
HaeIII GGCC 1 cut(s) 8
HapII CCGG 1 cut(s) 5
Hin1II CATG 4 cut(s) 286, 533, 655, 907
HincII GTYRAC 2 cut(s) 748, 918
HindII GTYRAC 2 cut(s) 748, 918
HinfI GANTC 2 cut(s) 135, 551
HpaI GTTAAC 1 cut(s) 918
HpaII CCGG 1 cut(s) 5
HphI GGTGA 1 cut(s) 76
Hpy166II GTNNAC 5 cut(s) 84, 446, 545, 748, 918
Hpy188I TCNGA 5 cut(s) 20, 301, 332, 667, 834
Hpy188III TCNNGA 2 cut(s) 209, 518
Hpy8I GTNNAC 5 cut(s) 84, 446, 545, 748, 918
Hpy99I CGWCG 3 cut(s) 491, 631, 806
HpyAV CCTTC 4 cut(s) 194, 649, 688, 871
HpyCH4III ACNGT 2 cut(s) 438, 631
HpyCH4IV ACGT 1 cut(s) 486
HpyCH4V TGCA 5 cut(s) 127, 282, 358, 457, 685
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 329
HpySE526I ACGT 1 cut(s) 486
Hsp92II CATG 4 cut(s) 286, 533, 655, 907
KroI GCCGGC 1 cut(s) 4
KroNI GCCGGC 1 cut(s) 6
KspAI GTTAAC 1 cut(s) 918
Kzo9I GATC 4 cut(s) 15, 100, 154, 205
LmnI GCTCC 5 cut(s) 379, 520, 526, 761, 856
Lsp1109I GCAGC 3 cut(s) 342, 469, 504
LweI GCATC 2 cut(s) 154, 694
MaeI CTAG 4 cut(s) 116, 308, 396, 704
MaeII ACGT 1 cut(s) 486
MaeIII GTNAC 2 cut(s) 290, 482
MalI GATC 4 cut(s) 17, 102, 156, 207
MboI GATC 4 cut(s) 15, 100, 154, 205
MboII GAAGA 7 cut(s) 110, 298, 374, 444, 668, 821, 941
MfeI CAATTG 2 cut(s) 314, 578
MflI RGATCY 2 cut(s) 100, 205
MhlI GDGCHC 2 cut(s) 384, 758
MluCI AATT 7 cut(s) 107, 171, 314, 578, 709, 924, 955
MmeI TCCRAC 4 cut(s) 241, 324, 667, 798
MroNI GCCGGC 1 cut(s) 4
MseI TTAA 3 cut(s) 54, 917, 958
MslI CAYNNNNRTG 1 cut(s) 908
MspA1I CMGCKG 2 cut(s) 28, 495
MspI CCGG 1 cut(s) 5
MunI CAATTG 2 cut(s) 314, 578
MvnI CGCG 2 cut(s) 408, 922
MwoI GCNNNNNNNGC 1 cut(s) 10
NaeI GCCGGC 1 cut(s) 6
NdeII GATC 4 cut(s) 15, 100, 154, 205
NgoMIV GCCGGC 1 cut(s) 4
NlaIII CATG 4 cut(s) 286, 533, 655, 907
NlaIV GGNNCC 1 cut(s) 765
NmuCI GTSAC 1 cut(s) 482
NspI RCATGY 1 cut(s) 533
PcsI WCGNNNNNNNCGW 2 cut(s) 139, 744
PdiI GCCGGC 1 cut(s) 6
PfeI GAWTC 2 cut(s) 135, 551
PkrI GCNGC 3 cut(s) 357, 459, 494
PpuMI RGGWCCY 1 cut(s) 636
PsiI TTATAA 1 cut(s) 672
Psp124BI GAGCTC 1 cut(s) 384
Psp5II RGGWCCY 1 cut(s) 636
PspN4I GGNNCC 1 cut(s) 765
PspPI GGNCC 2 cut(s) 23, 636
PspPPI RGGWCCY 1 cut(s) 636
PstI CTGCAG 1 cut(s) 360
PsuI RGATCY 2 cut(s) 100, 205
RsaI GTAC 2 cut(s) 76, 576
RsaNI GTAC 2 cut(s) 75, 575
RseI CAYNNNNRTG 1 cut(s) 908
SacI GAGCTC 1 cut(s) 384
SalI GTCGAC 1 cut(s) 746
SaqAI TTAA 3 cut(s) 54, 917, 958
SatI GCNGC 3 cut(s) 356, 458, 493
Sau3AI GATC 4 cut(s) 15, 100, 154, 205
Sau96I GGNCC 2 cut(s) 23, 636
SduI GDGCHC 2 cut(s) 384, 758
SfaNI GCATC 2 cut(s) 154, 694
SfcI CTRYAG 1 cut(s) 356
SinI GGWCC 2 cut(s) 23, 636
SmiMI CAYNNNNRTG 1 cut(s) 908
SmlI CTYRAG 4 cut(s) 209, 350, 768, 812
SmoI CTYRAG 4 cut(s) 209, 350, 768, 812
Sse9I AATT 7 cut(s) 107, 171, 314, 578, 709, 924, 955
SsiI CCGC 3 cut(s) 26, 167, 495
SspMI CTAG 4 cut(s) 116, 308, 396, 704
SstI GAGCTC 1 cut(s) 384
StyI CCWWGG 2 cut(s) 759, 885
TaaI ACNGT 2 cut(s) 438, 631
TaiI ACGT 1 cut(s) 489
TaqI TCGA 5 cut(s) 96, 142, 626, 738, 747
TasI AATT 7 cut(s) 107, 171, 314, 578, 709, 924, 955
TatI WGTACW 2 cut(s) 74, 574
TfiI GAWTC 2 cut(s) 135, 551
Tru1I TTAA 3 cut(s) 54, 917, 958
Tru9I TTAA 3 cut(s) 54, 917, 958
TscAI CASTG 1 cut(s) 284
TseFI GTSAC 1 cut(s) 482
TseI GCWGC 3 cut(s) 355, 457, 492
Tsp45I GTSAC 1 cut(s) 482
TspDTI ATGAA 3 cut(s) 164, 299, 807
TspRI CASTG 1 cut(s) 284
VpaK11BI GGWCC 2 cut(s) 23, 636
XapI RAATTY 2 cut(s) 107, 171
XceI RCATGY 1 cut(s) 533
XmiI GTMKAC 2 cut(s) 544, 747
XspI CTAG 4 cut(s) 116, 308, 396, 704
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.