Rh1DG017800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0000499
Physical Location & Seq
Reverse (-)
2874875 .. 2875057
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG017800.1

Sequence Viewer

Length: 183 bp
ATGGAGGCTCTGAAAAAGCAATTGCAAGAGGAGTTTGAGGCACTGCATGGCCAGATTGCCAAGATTGTTGGGGACAACGAGAAAGAATGGAAGACGATCGAGAAGCAAGTGAGTGACCTAGAAGAGACGACGAACCAGTTGCTAGGCATGGTTCCCGTTGCAAAGGAGAGTGATGATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.84

Weight (kDa)

4.48

Isoelectric Point (pI)

39.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000499)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G02510
fragaria_vesca FvH4_6g16970 FvH4_6g16980 FvH4_7g01220 FvH4_7g01220 FvH4_7g01220 FvH4_7g01240
malus_domestica MD05G1161500.v1.1
pyrus_communis pycom05g15160
rosa_chinensis RchiOBHm_Chr1g0316711 RchiOBHm_Chr1g0316801 RchiOBHm_Chr1g0316871 RchiOBHm_Chr1g0316881 RchiOBHm_Chr1g0316951 RchiOBHm_Chr3g0470991 RchiOBHm_Chr4g0402171
rosa_laevigata RLG00000001679 RLG00000001680 RLG00000007591 RLG00000009108 RLG00000024215 RLG00000024221 RLG00000030636 RLG00000030640 RLG00000030642 RLG00000030648 RLG00000030651 RLG00000030658 RLG00000030667
rosa_multiflora Rmu_sc0000839.1_g000010 Rmu_sc0002667.1_g000003 Rmu_sc0003008.1_g000023 Rmu_sc0003008.1_g000047 Rmu_sc0005604.1_g000001 Rmu_sc0005939.1_g000001 Rmu_sc0006790.1_g000011 Rmu_sc0007472.1_g000004 Rmu_sc0017515.1_g000001 Rmu_sc0019753.1_g000003 Rmu_sc0020172.1_g000001 Rmu_sc0023783.1_g000001
rosa_roxburghii Rroxscaffold_4G00330760 Rroxscaffold_4G00330800 Rroxscaffold_4G00330810 Rroxscaffold_4G00330950
rosa_rugosa Rorug01G0011200 Rorug01G0011500 Rorug01G0011600 Rorug01G0012300 Rorug01G0012300 Rorug01G0012400 Rorug01G0012500 Rorug01G0012600 Rorug01G0012600 Rorug01G0013400 Rorug01G0013400 Rorug01G0013500
rosa_samantha Rh1AG021100 Rh1AG022800 Rh1AG023300 Rh1AG023500 Rh1AG024000 Rh1AG024300 Rh1BG016000 Rh1BG016300 Rh1BG021300 Rh1BG021500 Rh1CG020300 Rh1CG022500 Rh1DG016300 Rh1DG016400 Rh1DG017300 Rh1DG017400 Rh1DG017700 Rh1DG017800 Rh1DG018200 Rh1DG019100 Rh1DG019900 Rh1DG020200 Rh1DG020800 Rh1DG021300 Rh1DG021400 Rh1DG021800 Rh3DG186400
rosa_wichuraiana Rw1G001370 Rw1G001480 Rw1G001650 Rw1G001680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 49
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 49
BalI TGGCCA 1 cut(s) 51
BbsI GAAGAC 1 cut(s) 98
BcgI CGANNNNNNTGC 2 cut(s) 121, 155
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 2 cut(s) 119, 143
BmiI GGNNCC 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 98
Bse1I ACTGG 1 cut(s) 136
BseNI ACTGG 1 cut(s) 136
BseRI GAGGAG 1 cut(s) 44
Bsh1285I CGRYCG 1 cut(s) 99
BshFI GGCC 1 cut(s) 51
BsiEI CGRYCG 1 cut(s) 99
BslFI GGGAC 1 cut(s) 86
BsmAI GTCTC 1 cut(s) 119
BsmBI CGTCTC 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 86
BsnI GGCC 1 cut(s) 51
Bsp143I GATC 1 cut(s) 96
BspANI GGCC 1 cut(s) 51
BspLI GGNNCC 1 cut(s) 153
BsrI ACTGG 1 cut(s) 136
BssMI GATC 1 cut(s) 96
Bst6I CTCTTC 1 cut(s) 117
BstKTI GATC 1 cut(s) 99
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 96
BstMCI CGRYCG 1 cut(s) 99
BstV2I GAAGAC 1 cut(s) 98
BsuRI GGCC 1 cut(s) 51
BtsI GCAGTG 1 cut(s) 41
BtsIMutI CAGTG 1 cut(s) 41
CviAII CATG 2 cut(s) 47, 148
CviJI RGCY 2 cut(s) 8, 51
CviKI_1 RGCY 2 cut(s) 8, 51
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
EaeI YGGCCR 1 cut(s) 49
Eam1104I CTCTTC 1 cut(s) 117
EarI CTCTTC 1 cut(s) 117
Esp3I CGTCTC 1 cut(s) 119
FaeI CATG 2 cut(s) 50, 151
FaiI YATR 2 cut(s) 48, 149
FaqI GGGAC 1 cut(s) 86
FatI CATG 2 cut(s) 46, 147
FspBI CTAG 2 cut(s) 119, 143
HaeIII GGCC 1 cut(s) 51
Hin1II CATG 2 cut(s) 50, 151
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 100
Hpy99I CGWCG 1 cut(s) 133
HpyCH4V TGCA 3 cut(s) 25, 46, 161
Hsp92II CATG 2 cut(s) 50, 151
Kzo9I GATC 1 cut(s) 96
LpnPI CCDG 2 cut(s) 65, 149
MaeI CTAG 2 cut(s) 119, 143
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MboII GAAGA 2 cut(s) 103, 134
MfeI CAATTG 1 cut(s) 20
MlsI TGGCCA 1 cut(s) 51
MluCI AATT 1 cut(s) 20
MluNI TGGCCA 1 cut(s) 51
MnlI CCTC 2 cut(s) 22, 31
Mox20I TGGCCA 1 cut(s) 51
MscI TGGCCA 1 cut(s) 51
Msp20I TGGCCA 1 cut(s) 51
MunI CAATTG 1 cut(s) 20
NdeII GATC 1 cut(s) 96
NlaIII CATG 2 cut(s) 50, 151
NlaIV GGNNCC 1 cut(s) 153
NmuCI GTSAC 1 cut(s) 113
Ple19I CGATCG 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 153
PvuI CGATCG 1 cut(s) 99
Sau3AI GATC 1 cut(s) 96
SetI ASST 1 cut(s) 120
Sse9I AATT 1 cut(s) 20
SspMI CTAG 2 cut(s) 119, 143
TaqI TCGA 1 cut(s) 99
TasI AATT 1 cut(s) 20
TscAI CASTG 1 cut(s) 48
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspRI CASTG 1 cut(s) 48
XspI CTAG 2 cut(s) 119, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.