Rh6AG165600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0000575
Physical Location & Seq
Forward (+)
26390546 .. 26391618
1073 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG165600.1

Sequence Viewer

Length: 189 bp
ATGGACGACGGCCTCAACGAGGACTTCGGTTACGATTCAGATATCTACTGCGTTGACACCTCGCTGCAAGCGTCCGATTCGAATCATGTGGACATCAATCCAGAAGTTATCTGCAATGGCACTGAAACCACTGTCGGGCGATATGGAGTTCGATTCCTACGTGCTGACACCCACGGGTGGGATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.92

Weight (kDa)

4.05

Isoelectric Point (pI)

14.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 4 cut(s) 19, 135, 177, 178
AoxI GGCC 1 cut(s) 10
ApeKI GCWGC 1 cut(s) 64
AsuII TTCGAA 1 cut(s) 80
BbvI GCAGC 1 cut(s) 51
BceAI ACGGC 1 cut(s) 25
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
Bpu14I TTCGAA 1 cut(s) 80
BsaAI YACGTR 1 cut(s) 161
BsaBI GATNNNNATC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 4 cut(s) 19, 135, 177, 178
Bse3DI GCAATG 1 cut(s) 121
Bse8I GATNNNNATC 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 172
BseGI GGATG 1 cut(s) 187
BseJI GATNNNNATC 1 cut(s) 81
BseLI CCNNNNNNNGG 4 cut(s) 19, 135, 177, 178
BseMI GCAATG 1 cut(s) 121
BseXI GCAGC 1 cut(s) 51
BshFI GGCC 1 cut(s) 12
BslI CCNNNNNNNGG 4 cut(s) 19, 135, 177, 178
BsnI GGCC 1 cut(s) 12
Bsp119I TTCGAA 1 cut(s) 80
BspANI GGCC 1 cut(s) 12
BspT104I TTCGAA 1 cut(s) 80
BsrDI GCAATG 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 133
BstBAI YACGTR 1 cut(s) 161
BstBI TTCGAA 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 69
BstDSI CCRYGG 1 cut(s) 172
BstENI CCTNNNNNAGG 1 cut(s) 17
BstF5I GGATG 1 cut(s) 187
BstV1I GCAGC 1 cut(s) 51
BsuRI GGCC 1 cut(s) 12
BtgI CCRYGG 1 cut(s) 172
BtsCI GGATG 1 cut(s) 187
BtsIMutI CAGTG 2 cut(s) 120, 129
Cac8I GCNNGC 1 cut(s) 69
CseI GACGC 1 cut(s) 60
CviAII CATG 1 cut(s) 86
CviJI RGCY 1 cut(s) 12
CviKI_1 RGCY 1 cut(s) 12
Eco32I GATATC 1 cut(s) 43
EcoNI CCTNNNNNAGG 1 cut(s) 17
EcoRV GATATC 1 cut(s) 43
FaeI CATG 1 cut(s) 89
FaiI YATR 2 cut(s) 87, 144
FatI CATG 1 cut(s) 85
Fnu4HI GCNGC 1 cut(s) 65
Fsp4HI GCNGC 1 cut(s) 65
GluI GCNGC 1 cut(s) 65
HaeIII GGCC 1 cut(s) 12
HgaI GACGC 1 cut(s) 60
Hin1II CATG 1 cut(s) 89
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 4 cut(s) 35, 77, 82, 153
Hpy166II GTNNAC 2 cut(s) 55, 91
Hpy188I TCNGA 2 cut(s) 40, 76
Hpy188III TCNNGA 1 cut(s) 101
Hpy8I GTNNAC 2 cut(s) 55, 91
Hpy99I CGWCG 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 133
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 67, 114
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 1 cut(s) 89
LpnPI CCDG 1 cut(s) 114
Lsp1109I GCAGC 1 cut(s) 51
MaeII ACGT 1 cut(s) 160
MaeIII GTNAC 1 cut(s) 29
MnlI CCTC 3 cut(s) 13, 23, 70
NlaIII CATG 1 cut(s) 89
NspV TTCGAA 1 cut(s) 80
PcsI WCGNNNNNNNCGW 3 cut(s) 15, 68, 157
PfeI GAWTC 4 cut(s) 35, 77, 82, 153
PkrI GCNGC 1 cut(s) 66
Ppu21I YACGTR 1 cut(s) 161
SatI GCNGC 1 cut(s) 65
SetI ASST 2 cut(s) 62, 163
SfuI TTCGAA 1 cut(s) 80
SgeI CNNG 8 cut(s) 31, 73, 80, 98, 113, 148, 173, 185
TaaI ACNGT 1 cut(s) 133
TaiI ACGT 1 cut(s) 163
TaqI TCGA 2 cut(s) 80, 151
TfiI GAWTC 4 cut(s) 35, 77, 82, 153
TscAI CASTG 2 cut(s) 127, 136
TseI GCWGC 1 cut(s) 64
TspRI CASTG 2 cut(s) 127, 136
XagI CCTNNNNNAGG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.