Rh7BG447400
ERF Family

Haem-binding uptake, Tiki superfamily, ChaN

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
52234359 .. 52236721
2363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG447400.1

Sequence Viewer

Length: 264 bp
ATGGCGTCGATTTCAAGTGGTTTCCGTGAGTACTTGAAACGTAGTAAGTTTTACTGGCACATTAGTACTCCGTTCTGTGTTTCTGAATTACTTTTGATTCACCCAAACATGAGGGTCTCGCAAGAGTTGCAGATTATTGCTGGACTAGTGGAGCATCGACTTTCTGATGAATTTTCTTCTCAAACAATACTTGTTGCTTCTGTAGAAAATGATCCAGGTGGTGGAAATGAGGTTGAAACATCGGACCTGTACCCTCCTCCTTAA

Protein Analysis

87

Amino Acids

9.77

Weight (kDa)

4.96

Isoelectric Point (pI)

57.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 221
AclWI GGATC 1 cut(s) 206
AcsI RAATTY 1 cut(s) 170
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 3 cut(s) 32, 67, 251
AfiI CCNNNNNNNGG 1 cut(s) 221
AgsI TTSAA 3 cut(s) 15, 37, 236
AhlI ACTAGT 1 cut(s) 145
AjnI CCWGG 1 cut(s) 214
Alw26I GTCTC 1 cut(s) 121
AlwI GGATC 1 cut(s) 206
ApoI RAATTY 1 cut(s) 170
AspS9I GGNCC 1 cut(s) 244
AsuHPI GGTGA 1 cut(s) 92
AvaII GGWCC 1 cut(s) 244
BciT130I CCWGG 1 cut(s) 216
BcoDI GTCTC 1 cut(s) 121
BcuI ACTAGT 1 cut(s) 145
BfaI CTAG 1 cut(s) 146
BfmI CTRYAG 1 cut(s) 201
BmcAI AGTACT 2 cut(s) 32, 67
Bme1390I CCNGG 1 cut(s) 216
Bme18I GGWCC 1 cut(s) 244
BmgT120I GGNCC 1 cut(s) 244
BmrFI CCNGG 1 cut(s) 216
BmsI GCATC 1 cut(s) 163
BsaHI GRCGYC 1 cut(s) 5
BsaI GGTCTC 1 cut(s) 121
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse1I ACTGG 1 cut(s) 59
BseBI CCWGG 1 cut(s) 216
BseLI CCNNNNNNNGG 1 cut(s) 221
BseNI ACTGG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 246
BslI CCNNNNNNNGG 1 cut(s) 221
BsmAI GTCTC 1 cut(s) 121
Bso31I GGTCTC 1 cut(s) 121
Bsp143I GATC 1 cut(s) 211
BspPI GGATC 1 cut(s) 206
BspTNI GGTCTC 1 cut(s) 121
BsrI ACTGG 1 cut(s) 59
BssMI GATC 1 cut(s) 211
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 216
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 127
BstKTI GATC 1 cut(s) 214
BstMAI GTCTC 1 cut(s) 121
BstMBI GATC 1 cut(s) 211
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 216
BstSCI CCNGG 1 cut(s) 214
BstSFI CTRYAG 1 cut(s) 201
Cfr13I GGNCC 1 cut(s) 244
Csp6I GTAC 3 cut(s) 31, 66, 250
CviAII CATG 1 cut(s) 109
CviQI GTAC 3 cut(s) 31, 66, 250
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eco31I GGTCTC 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 244
EcoRII CCWGG 1 cut(s) 214
FaeI CATG 1 cut(s) 112
FaiI YATR 1 cut(s) 110
FatI CATG 1 cut(s) 108
FspBI CTAG 1 cut(s) 146
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 1 cut(s) 112
HinfI GANTC 1 cut(s) 97
HphI GGTGA 1 cut(s) 92
Hpy188I TCNGA 3 cut(s) 85, 166, 244
Hpy99I CGWCG 1 cut(s) 10
HpyCH4IV ACGT 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 130
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpySE526I ACGT 1 cut(s) 40
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 1 cut(s) 211
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 5 cut(s) 40, 126, 201, 228, 260
LweI GCATC 1 cut(s) 163
MaeI CTAG 1 cut(s) 146
MaeII ACGT 1 cut(s) 40
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 1 cut(s) 168
MluCI AATT 2 cut(s) 86, 170
MnlI CCTC 3 cut(s) 105, 223, 264
MseI TTAA 1 cut(s) 262
MspR9I CCNGG 1 cut(s) 216
MvaI CCWGG 1 cut(s) 216
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeII GATC 1 cut(s) 211
NlaIII CATG 1 cut(s) 112
PfeI GAWTC 1 cut(s) 97
PflMI CCANNNNNTGG 1 cut(s) 221
Psp6I CCWGG 1 cut(s) 214
PspGI CCWGG 1 cut(s) 214
PspPI GGNCC 1 cut(s) 244
RsaI GTAC 3 cut(s) 32, 67, 251
RsaNI GTAC 3 cut(s) 31, 66, 250
SaqAI TTAA 1 cut(s) 262
Sau3AI GATC 1 cut(s) 211
Sau96I GGNCC 1 cut(s) 244
ScaI AGTACT 2 cut(s) 32, 67
ScrFI CCNGG 1 cut(s) 216
SetI ASST 4 cut(s) 43, 220, 234, 249
SfaNI GCATC 1 cut(s) 163
SfcI CTRYAG 1 cut(s) 201
SinI GGWCC 1 cut(s) 244
SpeI ACTAGT 1 cut(s) 145
Sse9I AATT 2 cut(s) 86, 170
SspMI CTAG 1 cut(s) 146
StyD4I CCNGG 1 cut(s) 214
TaiI ACGT 1 cut(s) 43
TaqI TCGA 2 cut(s) 8, 157
TasI AATT 2 cut(s) 86, 170
TatI WGTACW 2 cut(s) 30, 65
TfiI GAWTC 1 cut(s) 97
Tru1I TTAA 1 cut(s) 262
Tru9I TTAA 1 cut(s) 262
TspDTI ATGAA 1 cut(s) 183
TspGWI ACGGA 2 cut(s) 14, 60
Van91I CCANNNNNTGG 1 cut(s) 221
VpaK11BI GGWCC 1 cut(s) 244
XapI RAATTY 1 cut(s) 170
XspI CTAG 1 cut(s) 146
ZrmI AGTACT 2 cut(s) 32, 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.