FvH4_1g21691

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
OG0000687
Physical Location & Seq
Forward (+)
13661955 .. 13662544
590 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g21691.t1

Sequence Viewer

Length: 261 bp
ATGATGGTGGTGGAGAACGATCTGATGCATCTGAAGGAAAAGAAGACAAGACGTGCAACCCAGCTCGATCAAATTTTCACGGAAAAGAGGGTGAATGTCTGCTATCCACCATTGCCTCATGTACGGCTTCTTGAAGTGGAGATCAATGATCCTGCAACTGAACGACTTAGGGAGTTGGAGGAATCCCTGAGGACAGCAAAACCAATAGCAAGACTAGAGTTTGTTGAACTAAGGGACAAGCGTTTCACTAATTTCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.33

Weight (kDa)

8.89

Isoelectric Point (pI)

49.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 143
AcsI RAATTY 1 cut(s) 72
AcuI CTGAAG 1 cut(s) 53
AfaI GTAC 1 cut(s) 123
AgsI TTSAA 3 cut(s) 134, 227, 256
AjiI CACGTC 1 cut(s) 53
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
AlwI GGATC 1 cut(s) 143
ApoI RAATTY 1 cut(s) 72
AsuHPI GGTGA 1 cut(s) 103
AxyI CCTNAGG 1 cut(s) 188
BbsI GAAGAC 1 cut(s) 50
BceAI ACGGC 1 cut(s) 140
BfaI CTAG 1 cut(s) 215
BmgBI CACGTC 1 cut(s) 53
BmsI GCATC 2 cut(s) 15, 37
BpiI GAAGAC 1 cut(s) 50
Bse21I CCTNAGG 1 cut(s) 188
Bse3DI GCAATG 1 cut(s) 110
BseMI GCAATG 1 cut(s) 110
BseMII CTCAG 1 cut(s) 179
BseYI CCCAGC 1 cut(s) 60
BslFI GGGAC 1 cut(s) 248
BsmFI GGGAC 1 cut(s) 248
Bsp143I GATC 4 cut(s) 19, 67, 141, 148
BspCNI CTCAG 1 cut(s) 180
BspPI GGATC 1 cut(s) 143
BsrDI GCAATG 1 cut(s) 110
BssMI GATC 4 cut(s) 19, 67, 141, 148
BstDEI CTNAG 3 cut(s) 167, 188, 230
BstKTI GATC 4 cut(s) 22, 70, 144, 151
BstMBI GATC 4 cut(s) 19, 67, 141, 148
BstV2I GAAGAC 1 cut(s) 50
Bsu36I CCTNAGG 1 cut(s) 188
BtrI CACGTC 1 cut(s) 53
Csp6I GTAC 1 cut(s) 122
CviAII CATG 1 cut(s) 119
CviJI RGCY 2 cut(s) 64, 127
CviKI_1 RGCY 2 cut(s) 64, 127
CviQI GTAC 1 cut(s) 122
DdeI CTNAG 3 cut(s) 167, 188, 230
DpnI GATC 4 cut(s) 21, 69, 143, 150
DpnII GATC 4 cut(s) 19, 67, 141, 148
Eco57I CTGAAG 1 cut(s) 53
Eco81I CCTNAGG 1 cut(s) 188
EcoT22I ATGCAT 1 cut(s) 30
FaeI CATG 1 cut(s) 122
FaiI YATR 1 cut(s) 120
FaqI GGGAC 1 cut(s) 248
FatI CATG 1 cut(s) 118
FspBI CTAG 1 cut(s) 215
GsaI CCCAGC 1 cut(s) 64
Hin1II CATG 1 cut(s) 122
HinfI GANTC 1 cut(s) 182
HphI GGTGA 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 24, 33
Hpy188III TCNNGA 1 cut(s) 131
HpyAV CCTTC 1 cut(s) 28
HpyCH4IV ACGT 1 cut(s) 52
HpyCH4V TGCA 3 cut(s) 28, 56, 155
HpyF3I CTNAG 3 cut(s) 167, 188, 230
HpySE526I ACGT 1 cut(s) 52
Hsp92II CATG 1 cut(s) 122
Kzo9I GATC 4 cut(s) 19, 67, 141, 148
LpnPI CCDG 3 cut(s) 74, 165, 200
LweI GCATC 2 cut(s) 15, 37
MaeI CTAG 1 cut(s) 215
MaeII ACGT 1 cut(s) 52
MalI GATC 4 cut(s) 21, 69, 143, 150
MboI GATC 4 cut(s) 19, 67, 141, 148
MboII GAAGA 1 cut(s) 55
MluCI AATT 2 cut(s) 72, 250
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 4 cut(s) 81, 126, 172, 183
Mph1103I ATGCAT 1 cut(s) 30
NdeII GATC 4 cut(s) 19, 67, 141, 148
NlaIII CATG 1 cut(s) 122
NsiI ATGCAT 1 cut(s) 30
PfeI GAWTC 1 cut(s) 182
PspFI CCCAGC 1 cut(s) 60
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
Sau3AI GATC 4 cut(s) 19, 67, 141, 148
SetI ASST 2 cut(s) 55, 66
SfaNI GCATC 2 cut(s) 15, 37
Sse9I AATT 2 cut(s) 72, 250
SspMI CTAG 1 cut(s) 215
TaiI ACGT 1 cut(s) 55
TaqI TCGA 1 cut(s) 66
TasI AATT 2 cut(s) 72, 250
TfiI GAWTC 1 cut(s) 182
TspGWI ACGGA 1 cut(s) 95
XapI RAATTY 1 cut(s) 72
XspI CTAG 1 cut(s) 215
Zsp2I ATGCAT 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.