pycom10g23240

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
25446019 .. 25446309
291 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g23240.1

Sequence Viewer

Length: 291 bp
ATGAGCAAAGAAACAGCAAGAAGATCAAAGGCAGAACGCAAGGCAGACAAAACAGGTAGCAACAACGCAAACATGGATAACAATCTCAACATGGAAGACAAAACGCAAGAATATCAAGAACAATATGCCGCAATGGTCAAAAGTACACCCGAGTTACCTGATCTTGTTATCTGCCAGATTCTCCAACTCCTATCCACCAGATATGCCATACGGGCCAGCATACTCTCCAAGCAGTGGGAAAGGTGTTGTGCTAAGAAAGCACCAAAATCTTTTGGAACCAACTCAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.86

Weight (kDa)

9.27

Isoelectric Point (pI)

45.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 51 - 86 7.8e-07 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 234
AciI CCGC 1 cut(s) 129
AfaI GTAC 1 cut(s) 145
AfiI CCNNNNNNNGG 1 cut(s) 234
AluBI AGCT 1 cut(s) 288
AluI AGCT 1 cut(s) 288
Ama87I CYCGRG 1 cut(s) 149
AoxI GGCC 1 cut(s) 213
AspS9I GGNCC 1 cut(s) 213
AvaI CYCGRG 1 cut(s) 149
BbsI GAAGAC 1 cut(s) 102
BglI GCCNNNNNGGC 1 cut(s) 212
BisI GCNGC 1 cut(s) 129
BlsI GCNGC 1 cut(s) 130
BmeT110I CYCGRG 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 213
BmiI GGNNCC 1 cut(s) 277
BpiI GAAGAC 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 268
BsaBI GATNNNNATC 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 234
Bse3DI GCAATG 1 cut(s) 138
Bse8I GATNNNNATC 1 cut(s) 81
BseJI GATNNNNATC 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 234
BseMI GCAATG 1 cut(s) 138
BshFI GGCC 1 cut(s) 215
BsiHKCI CYCGRG 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 234
BsnI GGCC 1 cut(s) 215
BsoBI CYCGRG 1 cut(s) 149
Bsp143I GATC 2 cut(s) 23, 160
BspACI CCGC 1 cut(s) 129
BspANI GGCC 1 cut(s) 215
BspLI GGNNCC 1 cut(s) 277
BsrDI GCAATG 1 cut(s) 138
BssMI GATC 2 cut(s) 23, 160
BstC8I GCNNGC 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 252
BstKTI GATC 2 cut(s) 26, 163
BstMBI GATC 2 cut(s) 23, 160
BstMWI GCNNNNNNNGC 2 cut(s) 212, 257
BstV2I GAAGAC 1 cut(s) 102
BsuRI GGCC 1 cut(s) 215
BtsI GCAGTG 1 cut(s) 239
BtsIMutI CAGTG 1 cut(s) 239
Cac8I GCNNGC 1 cut(s) 217
Cfr13I GGNCC 1 cut(s) 213
Csp6I GTAC 1 cut(s) 144
CviAII CATG 2 cut(s) 73, 91
CviJI RGCY 2 cut(s) 215, 288
CviKI_1 RGCY 2 cut(s) 215, 288
CviQI GTAC 1 cut(s) 144
DdeI CTNAG 1 cut(s) 252
DpnI GATC 2 cut(s) 25, 162
DpnII GATC 2 cut(s) 23, 160
Eco88I CYCGRG 1 cut(s) 149
FaeI CATG 2 cut(s) 76, 94
FaiI YATR 6 cut(s) 74, 92, 126, 204, 209, 221
FatI CATG 2 cut(s) 72, 90
Fnu4HI GCNGC 1 cut(s) 129
Fsp4HI GCNGC 1 cut(s) 129
GluI GCNGC 1 cut(s) 129
HaeIII GGCC 1 cut(s) 215
Hin1II CATG 2 cut(s) 76, 94
HinfI GANTC 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 146
Hpy188III TCNNGA 1 cut(s) 116
Hpy8I GTNNAC 1 cut(s) 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 212, 257
HpyF3I CTNAG 1 cut(s) 252
Hsp92II CATG 2 cut(s) 76, 94
Kzo9I GATC 2 cut(s) 23, 160
LpnPI CCDG 5 cut(s) 39, 171, 188, 211, 229
MaeIII GTNAC 1 cut(s) 153
MalI GATC 2 cut(s) 25, 162
MboI GATC 2 cut(s) 23, 160
MboII GAAGA 2 cut(s) 33, 107
MmeI TCCRAC 1 cut(s) 208
MwoI GCNNNNNNNGC 2 cut(s) 212, 257
NdeII GATC 2 cut(s) 23, 160
NlaIII CATG 2 cut(s) 76, 94
NlaIV GGNNCC 1 cut(s) 277
PfeI GAWTC 1 cut(s) 178
PflMI CCANNNNNTGG 1 cut(s) 234
PkrI GCNGC 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 277
PspPI GGNCC 1 cut(s) 213
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SatI GCNGC 1 cut(s) 129
Sau3AI GATC 2 cut(s) 23, 160
Sau96I GGNCC 1 cut(s) 213
SetI ASST 4 cut(s) 58, 160, 245, 290
SmlI CTYRAG 1 cut(s) 283
SmoI CTYRAG 1 cut(s) 283
SsiI CCGC 1 cut(s) 129
TatI WGTACW 1 cut(s) 143
TauI GCSGC 1 cut(s) 131
TfiI GAWTC 1 cut(s) 178
TscAI CASTG 1 cut(s) 239
TspRI CASTG 1 cut(s) 239
Van91I CCANNNNNTGG 1 cut(s) 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.