Rroxscaffold_5G00377450

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000687
Physical Location & Seq
Forward (+)
58020263 .. 58021066
804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00377450.1

Sequence Viewer

Length: 234 bp
ATGGCAGGCTGTCCTTCCCTCGAGAATTTGTCAATAGTTAAATATAGAGGCTTCGATGAAAGAATTAAAGTTTCAAGTTCGAGCTTCAAATCCTTAGAAGTTTTCAACTCCGGTGTTGCACTCCAACTTGAAGCTATGAATCTAGAATCTTTTAGAATTGGTCAAAATGGTCATGCTTCCGACTATCGAGAGGTTGTTATGCAACATCCAGTTCTCTTCTTGTGGACCACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.67

Weight (kDa)

6.04

Isoelectric Point (pI)

21.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 25
AgsI TTSAA 4 cut(s) 75, 88, 106, 131
AluBI AGCT 2 cut(s) 84, 134
AluI AGCT 2 cut(s) 84, 134
Ama87I CYCGRG 1 cut(s) 20
ApoI RAATTY 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 225
AvaI CYCGRG 1 cut(s) 20
AvaII GGWCC 1 cut(s) 225
BfaI CTAG 1 cut(s) 143
Bme18I GGWCC 1 cut(s) 225
BmeT110I CYCGRG 1 cut(s) 20
BmgT120I GGNCC 1 cut(s) 225
BsaWI WCCGGW 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 209
BseGI GGATG 1 cut(s) 205
BseNI ACTGG 1 cut(s) 209
BsiHKCI CYCGRG 1 cut(s) 20
BsiSI CCGG 1 cut(s) 111
BsoBI CYCGRG 1 cut(s) 20
BsrI ACTGG 1 cut(s) 209
Bst6I CTCTTC 1 cut(s) 221
BstC8I GCNNGC 1 cut(s) 7
BstDEI CTNAG 2 cut(s) 94, 231
BstF5I GGATG 1 cut(s) 205
BtsCI GGATG 1 cut(s) 205
Cac8I GCNNGC 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 225
CviAII CATG 1 cut(s) 173
CviJI RGCY 4 cut(s) 9, 51, 84, 134
CviKI_1 RGCY 4 cut(s) 9, 51, 84, 134
DdeI CTNAG 2 cut(s) 94, 231
Eam1104I CTCTTC 1 cut(s) 221
EarI CTCTTC 1 cut(s) 221
Eco47I GGWCC 1 cut(s) 225
Eco88I CYCGRG 1 cut(s) 20
FaeI CATG 1 cut(s) 176
FaiI YATR 4 cut(s) 45, 137, 174, 200
FatI CATG 1 cut(s) 172
FokI GGATG 1 cut(s) 192
FspBI CTAG 1 cut(s) 143
HapII CCGG 1 cut(s) 111
Hin1II CATG 1 cut(s) 176
HinfI GANTC 2 cut(s) 139, 146
HpaII CCGG 1 cut(s) 111
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 3 cut(s) 22, 143, 188
Hpy8I GTNNAC 1 cut(s) 225
HpyAV CCTTC 1 cut(s) 24
HpyCH4V TGCA 2 cut(s) 119, 202
HpyF3I CTNAG 2 cut(s) 94, 231
Hsp92II CATG 1 cut(s) 176
LpnPI CCDG 2 cut(s) 124, 222
MaeI CTAG 1 cut(s) 143
MboII GAAGA 1 cut(s) 208
MluCI AATT 3 cut(s) 25, 63, 156
MmeI TCCRAC 2 cut(s) 148, 204
MnlI CCTC 3 cut(s) 29, 41, 184
MseI TTAA 2 cut(s) 39, 66
MspI CCGG 1 cut(s) 111
NlaIII CATG 1 cut(s) 176
PaeR7I CTCGAG 1 cut(s) 20
PfeI GAWTC 2 cut(s) 139, 146
PspPI GGNCC 1 cut(s) 225
SaqAI TTAA 2 cut(s) 39, 66
Sau96I GGNCC 1 cut(s) 225
SetI ASST 3 cut(s) 86, 136, 195
Sfr274I CTCGAG 1 cut(s) 20
SinI GGWCC 1 cut(s) 225
SlaI CTCGAG 1 cut(s) 20
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
Sse9I AATT 3 cut(s) 25, 63, 156
SspMI CTAG 1 cut(s) 143
TaqI TCGA 4 cut(s) 21, 54, 80, 187
TasI AATT 3 cut(s) 25, 63, 156
TfiI GAWTC 2 cut(s) 139, 146
Tru1I TTAA 2 cut(s) 39, 66
Tru9I TTAA 2 cut(s) 39, 66
TspDTI ATGAA 2 cut(s) 72, 152
VpaK11BI GGWCC 1 cut(s) 225
XapI RAATTY 1 cut(s) 25
XbaI TCTAGA 1 cut(s) 142
XhoI CTCGAG 1 cut(s) 20
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.