Rorug01G0298600

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
41488930 .. 41491603
2674 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0298600.1

Sequence Viewer

Length: 318 bp
ATGGATTCTGCTCAAGTCCCCCGTGTTGCAATAGATTTAGGAGAAGATATTTTAAATTATGCCAATATCCTCAATGGAAGCTCAGGGCATAATGATAATATGTTTTCAAAGTTTGGTTATCCTGCATCTGGTGATGCTATTAGCTATAGTCAGAACCCTATTCAAAGTCAAGTTGTTGTTCAAAGTGAACCCAAAACCACAAAGAAAGCTAAAAGAGCCAAGAATTTCTCCATTCAAGAAGACAACCTTCTTGTGTCTGCCTGGCTCAATACTACCCTTGATCCAGCAATAGGAAATGATAAAAAAGGTGCTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.3

Weight (kDa)

5.66

Isoelectric Point (pI)

47.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 275
AcsI RAATTY 1 cut(s) 223
AfiI CCNNNNNNNGG 2 cut(s) 128, 290
AgsI TTSAA 4 cut(s) 108, 164, 182, 236
AjnI CCWGG 1 cut(s) 260
AluBI AGCT 3 cut(s) 81, 144, 209
AluI AGCT 3 cut(s) 81, 144, 209
AlwI GGATC 1 cut(s) 275
ApeKI GCWGC 1 cut(s) 311
ApoI RAATTY 1 cut(s) 223
AsuHPI GGTGA 1 cut(s) 143
BbsI GAAGAC 1 cut(s) 246
BbvI GCAGC 1 cut(s) 298
BciT130I CCWGG 1 cut(s) 262
BfmI CTRYAG 1 cut(s) 145
BisI GCNGC 1 cut(s) 312
BlsI GCNGC 1 cut(s) 313
Bme1390I CCNGG 1 cut(s) 262
BmrFI CCNGG 1 cut(s) 262
BmsI GCATC 2 cut(s) 124, 134
BpiI GAAGAC 1 cut(s) 246
Bpu10I CCTNAGC 1 cut(s) 82
Bsc4I CCNNNNNNNGG 2 cut(s) 128, 290
BseBI CCWGG 1 cut(s) 262
BseLI CCNNNNNNNGG 2 cut(s) 128, 290
BseMII CTCAG 1 cut(s) 96
BseXI GCAGC 1 cut(s) 298
BslFI GGGAC 1 cut(s) 2
BslI CCNNNNNNNGG 2 cut(s) 128, 290
BsmFI GGGAC 1 cut(s) 2
Bsp143I GATC 1 cut(s) 280
BspCNI CTCAG 1 cut(s) 95
BspPI GGATC 1 cut(s) 275
BssMI GATC 1 cut(s) 280
Bst2UI CCWGG 1 cut(s) 262
BstDEI CTNAG 1 cut(s) 82
BstKTI GATC 1 cut(s) 283
BstMBI GATC 1 cut(s) 280
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 145
BstV1I GCAGC 1 cut(s) 298
BstV2I GAAGAC 1 cut(s) 246
CviJI RGCY 5 cut(s) 81, 144, 209, 218, 265
CviKI_1 RGCY 5 cut(s) 81, 144, 209, 218, 265
DdeI CTNAG 1 cut(s) 82
DpnI GATC 1 cut(s) 282
DpnII GATC 1 cut(s) 280
DraI TTTAAA 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 260
FaiI YATR 4 cut(s) 60, 90, 101, 147
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FaqI GGGAC 1 cut(s) 2
Fnu4HI GCNGC 1 cut(s) 312
Fsp4HI GCNGC 1 cut(s) 312
GluI GCNGC 1 cut(s) 312
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 188
Hpy188I TCNGA 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 236
Hpy8I GTNNAC 1 cut(s) 188
HpyAV CCTTC 1 cut(s) 257
HpyCH4V TGCA 2 cut(s) 29, 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpyF3I CTNAG 1 cut(s) 82
Kzo9I GATC 1 cut(s) 280
LpnPI CCDG 6 cut(s) 69, 114, 135, 247, 274, 297
Lsp1109I GCAGC 1 cut(s) 298
LweI GCATC 2 cut(s) 124, 134
MalI GATC 1 cut(s) 282
MboI GATC 1 cut(s) 280
MboII GAAGA 2 cut(s) 56, 251
MluCI AATT 2 cut(s) 55, 223
MnlI CCTC 1 cut(s) 80
MseI TTAA 2 cut(s) 53, 316
MspR9I CCNGG 1 cut(s) 262
MvaI CCWGG 1 cut(s) 262
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeII GATC 1 cut(s) 280
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 1 cut(s) 313
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
SaqAI TTAA 2 cut(s) 53, 316
SatI GCNGC 1 cut(s) 312
Sau3AI GATC 1 cut(s) 280
ScrFI CCNGG 1 cut(s) 262
SetI ASST 5 cut(s) 83, 146, 211, 249, 310
SfaNI GCATC 2 cut(s) 124, 134
SfcI CTRYAG 1 cut(s) 145
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 2 cut(s) 55, 223
StyD4I CCNGG 1 cut(s) 260
TasI AATT 2 cut(s) 55, 223
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 2 cut(s) 53, 316
Tru9I TTAA 2 cut(s) 53, 316
TseI GCWGC 1 cut(s) 311
XapI RAATTY 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.