Rmu_sc0007589.1_g000001

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007589.1
Physical Location & Seq
Forward (+)
8356 .. 8673
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007589.1_g000001.1.cds

Sequence Viewer

Length: 318 bp
atggcactcagcacggtactgccttatcttccagaccttgttatccaccaaattctccgattcgttccgaccaaagttgccgtccgcatgatctttgtttccaagcaatgggaaggtgtatggttttcagatccgatattagatttcgacgagagtattggcaattactatggccatgaccagcatgaaaagtttgtcaagttcatcaacaacatcttgaaaaggtatttgaaattttgtgatgatcaagaacttaaactcttagcagttaaaaaattcaggctttgcatgaggaggtacttatccagcgacgcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.5

Weight (kDa)

8.93

Isoelectric Point (pI)

43.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 108
AciI CCGC 1 cut(s) 85
AclWI GGATC 1 cut(s) 125
AcoI YGGCCR 1 cut(s) 172
AcsI RAATTY 3 cut(s) 51, 233, 275
AfaI GTAC 2 cut(s) 18, 299
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 2 cut(s) 220, 232
AlwI GGATC 1 cut(s) 125
AoxI GGCC 1 cut(s) 172
ApoI RAATTY 3 cut(s) 51, 233, 275
ArsI GACNNNNNNTTYG 2 cut(s) 66, 98
BalI TGGCCA 1 cut(s) 174
BceAI ACGGC 1 cut(s) 65
BclI TGATCA 1 cut(s) 244
Bsc4I CCNNNNNNNGG 1 cut(s) 108
Bse3DI GCAATG 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 113
BseMII CTCAG 1 cut(s) 22
BseRI GAGGAG 1 cut(s) 307
BshFI GGCC 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 108
BsnI GGCC 1 cut(s) 174
Bsp143I GATC 3 cut(s) 90, 130, 244
BspACI CCGC 1 cut(s) 85
BspANI GGCC 1 cut(s) 174
BspCNI CTCAG 1 cut(s) 21
BspPI GGATC 1 cut(s) 125
BsrDI GCAATG 1 cut(s) 113
BssMI GATC 3 cut(s) 90, 130, 244
Bst4CI ACNGT 1 cut(s) 16
BstDEI CTNAG 3 cut(s) 8, 262, 315
BstKTI GATC 3 cut(s) 93, 133, 247
BstMBI GATC 3 cut(s) 90, 130, 244
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
BsuRI GGCC 1 cut(s) 174
Csp6I GTAC 2 cut(s) 17, 298
CviAII CATG 4 cut(s) 88, 176, 185, 289
CviJI RGCY 2 cut(s) 174, 283
CviKI_1 RGCY 2 cut(s) 174, 283
CviQI GTAC 2 cut(s) 17, 298
DdeI CTNAG 3 cut(s) 8, 262, 315
DpnI GATC 3 cut(s) 92, 132, 246
DpnII GATC 3 cut(s) 90, 130, 244
EaeI YGGCCR 1 cut(s) 172
FaeI CATG 4 cut(s) 91, 179, 188, 292
FaiI YATR 6 cut(s) 89, 121, 171, 177, 186, 290
FatI CATG 4 cut(s) 87, 175, 184, 288
FbaI TGATCA 1 cut(s) 244
HaeIII GGCC 1 cut(s) 174
Hin1II CATG 4 cut(s) 91, 179, 188, 292
HinfI GANTC 1 cut(s) 60
Hpy188I TCNGA 4 cut(s) 59, 69, 130, 135
Hpy188III TCNNGA 3 cut(s) 32, 217, 248
Hpy99I CGWCG 2 cut(s) 152, 314
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 288
HpyF3I CTNAG 3 cut(s) 8, 262, 315
Hsp92II CATG 4 cut(s) 91, 179, 188, 292
Ksp22I TGATCA 1 cut(s) 244
Kzo9I GATC 3 cut(s) 90, 130, 244
LpnPI CCDG 3 cut(s) 45, 194, 265
MalI GATC 3 cut(s) 92, 132, 246
MboI GATC 3 cut(s) 90, 130, 244
MboII GAAGA 1 cut(s) 20
MflI RGATCY 1 cut(s) 130
MlsI TGGCCA 1 cut(s) 174
MluCI AATT 4 cut(s) 51, 163, 233, 275
MluNI TGGCCA 1 cut(s) 174
MmeI TCCRAC 1 cut(s) 92
MnlI CCTC 2 cut(s) 285, 288
Mox20I TGGCCA 1 cut(s) 174
MscI TGGCCA 1 cut(s) 174
MseI TTAA 2 cut(s) 255, 270
Msp20I TGGCCA 1 cut(s) 174
NdeII GATC 3 cut(s) 90, 130, 244
NlaIII CATG 4 cut(s) 91, 179, 188, 292
PfeI GAWTC 1 cut(s) 60
PflMI CCANNNNNTGG 1 cut(s) 108
PsuI RGATCY 1 cut(s) 130
RsaI GTAC 2 cut(s) 18, 299
RsaNI GTAC 2 cut(s) 17, 298
SaqAI TTAA 2 cut(s) 255, 270
Sau3AI GATC 3 cut(s) 90, 130, 244
SetI ASST 4 cut(s) 39, 118, 227, 299
Sse9I AATT 4 cut(s) 51, 163, 233, 275
SsiI CCGC 1 cut(s) 85
TaaI ACNGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 147
TasI AATT 4 cut(s) 51, 163, 233, 275
TfiI GAWTC 1 cut(s) 60
Tru1I TTAA 2 cut(s) 255, 270
Tru9I TTAA 2 cut(s) 255, 270
TspDTI ATGAA 2 cut(s) 193, 201
Van91I CCANNNNNTGG 1 cut(s) 108
XapI RAATTY 3 cut(s) 51, 233, 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.