Rh6BG070300

A Receptor for Ubiquitination Targets

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0000687
Physical Location & Seq
Reverse (-)
10644530 .. 10644769
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG070300.1

Sequence Viewer

Length: 240 bp
ATGGCTACAAATACAAAAATAGTAAAACACGATGAAGAAGATCAAGATGACCAAATCCCCATGGTGGTGGTGGACAAGATACGGCCTCACTTACCCAACCTTGTTATCCACCGAATCCAGTCACTCCTTCCCACCAAATCTGCCCTCCGCATGAGCTTTCTTTCCAAACAATGGGAAGGTGTGTGGTCTTTGTCCCCTGTTATAGATTTCGACCAGGGAGGTACACACACTGATGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box

Protein Analysis

79

Amino Acids

9.02

Weight (kDa)

5.39

Isoelectric Point (pI)

43.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 171
AciI CCGC 1 cut(s) 148
AfaI GTAC 1 cut(s) 223
AfiI CCNNNNNNNGG 2 cut(s) 64, 171
AjnI CCWGG 1 cut(s) 213
AluBI AGCT 1 cut(s) 156
AluI AGCT 1 cut(s) 156
AoxI GGCC 1 cut(s) 83
BceAI ACGGC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 215
BfaI CTAG 1 cut(s) 238
Bme1390I CCNGG 1 cut(s) 215
BmrFI CCNGG 1 cut(s) 215
BsaJI CCNNGG 2 cut(s) 60, 214
Bsc4I CCNNNNNNNGG 2 cut(s) 64, 171
Bse1I ACTGG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 215
BseDI CCNNGG 2 cut(s) 60, 214
BseLI CCNNNNNNNGG 2 cut(s) 64, 171
BseNI ACTGG 1 cut(s) 118
BshFI GGCC 1 cut(s) 85
BslFI GGGAC 1 cut(s) 178
BslI CCNNNNNNNGG 2 cut(s) 64, 171
BsmFI GGGAC 1 cut(s) 178
BsnI GGCC 1 cut(s) 85
Bsp143I GATC 1 cut(s) 40
Bsp19I CCATGG 1 cut(s) 60
BspACI CCGC 1 cut(s) 148
BspANI GGCC 1 cut(s) 85
BsrI ACTGG 1 cut(s) 118
BssECI CCNNGG 2 cut(s) 60, 214
BssMI GATC 1 cut(s) 40
BssT1I CCWWGG 1 cut(s) 60
Bst2UI CCWGG 1 cut(s) 215
BstDSI CCRYGG 1 cut(s) 60
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstNI CCWGG 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 213
BstXI CCANNNNNNTGG 1 cut(s) 67
BsuRI GGCC 1 cut(s) 85
BtgI CCRYGG 1 cut(s) 60
BtsIMutI CAGTG 1 cut(s) 228
Csp6I GTAC 1 cut(s) 222
CviAII CATG 2 cut(s) 61, 151
CviJI RGCY 3 cut(s) 5, 85, 156
CviKI_1 RGCY 3 cut(s) 5, 85, 156
CviQI GTAC 1 cut(s) 222
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco130I CCWWGG 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 213
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 2 cut(s) 64, 154
FaiI YATR 3 cut(s) 62, 152, 203
FaqI GGGAC 1 cut(s) 178
FatI CATG 2 cut(s) 60, 150
FspBI CTAG 1 cut(s) 238
HaeIII GGCC 1 cut(s) 85
Hin1II CATG 2 cut(s) 64, 154
HinfI GANTC 1 cut(s) 114
Hpy166II GTNNAC 2 cut(s) 73, 224
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 2 cut(s) 73, 224
HpyAV CCTTC 2 cut(s) 137, 170
Hsp92II CATG 2 cut(s) 64, 154
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 4 cut(s) 131, 200, 210, 227
MaeI CTAG 1 cut(s) 238
MaeIII GTNAC 1 cut(s) 120
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 2 cut(s) 47, 50
MnlI CCTC 3 cut(s) 96, 155, 212
MslI CAYNNNNRTG 2 cut(s) 65, 231
MspR9I CCNGG 1 cut(s) 215
MvaI CCWGG 1 cut(s) 215
NcoI CCATGG 1 cut(s) 60
NdeII GATC 1 cut(s) 40
NlaIII CATG 2 cut(s) 64, 154
NmuCI GTSAC 1 cut(s) 120
PfeI GAWTC 1 cut(s) 114
PflMI CCANNNNNTGG 1 cut(s) 171
Psp6I CCWGG 1 cut(s) 213
PspGI CCWGG 1 cut(s) 213
RsaI GTAC 1 cut(s) 223
RsaNI GTAC 1 cut(s) 222
RseI CAYNNNNRTG 2 cut(s) 65, 231
Sau3AI GATC 1 cut(s) 40
ScrFI CCNGG 1 cut(s) 215
SetI ASST 4 cut(s) 102, 158, 181, 223
SmiMI CAYNNNNRTG 2 cut(s) 65, 231
SsiI CCGC 1 cut(s) 148
SspMI CTAG 1 cut(s) 238
StyD4I CCNGG 1 cut(s) 213
StyI CCWWGG 1 cut(s) 60
TaqI TCGA 1 cut(s) 210
TfiI GAWTC 1 cut(s) 114
TscAI CASTG 1 cut(s) 235
TseFI GTSAC 1 cut(s) 120
Tsp45I GTSAC 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 48
TspRI CASTG 1 cut(s) 235
Van91I CCANNNNNTGG 1 cut(s) 171
XcmI CCANNNNNNNNNTGG 1 cut(s) 67
XspI CTAG 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.