FvH4_4g10232

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000776
Physical Location & Seq
Forward (+)
13465008 .. 13465630
623 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g10232.t1

Sequence Viewer

Length: 231 bp
ATGTTCTATAATTCTAAGGGTTGTTCCCCTCCTTTGATTAATACACGATCGGCGGCTAACACGACCAACCGTGGTAAGAAGGAGTCGGAGCACCACACAGGGCGGCTACCTATCATCTACAGGGTGGTCCACCACAAAGAGAAGGGTGAGGAATTTCTTGTTATCCCATCTTACACAGAGTCGTATGATACAGTCAACAACCCTAAAGCTGCCAAGAATCTTGTAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.57

Weight (kDa)

9.42

Isoelectric Point (pI)

35.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 53, 103
AcsI RAATTY 1 cut(s) 152
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
Alw21I GWGCWC 1 cut(s) 93
ApeKI GCWGC 1 cut(s) 209
ApoI RAATTY 1 cut(s) 152
AseI ATTAAT 1 cut(s) 39
AspS9I GGNCC 1 cut(s) 127
AsuHPI GGTGA 1 cut(s) 158
AvaII GGWCC 1 cut(s) 127
Bbv12I GWGCWC 1 cut(s) 93
BbvI GCAGC 1 cut(s) 196
BccI CCATC 1 cut(s) 175
BfmI CTRYAG 1 cut(s) 118
BisI GCNGC 3 cut(s) 54, 104, 210
BlsI GCNGC 3 cut(s) 55, 105, 211
Bme18I GGWCC 1 cut(s) 127
BmgT120I GGNCC 1 cut(s) 127
BsaJI CCNNGG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 70
BseXI GCAGC 1 cut(s) 196
Bsh1285I CGRYCG 1 cut(s) 50
BsiEI CGRYCG 1 cut(s) 50
BsiHKAI GWGCWC 1 cut(s) 93
Bsp1286I GDGCHC 1 cut(s) 93
Bsp143I GATC 1 cut(s) 47
BspACI CCGC 2 cut(s) 53, 103
BssECI CCNNGG 1 cut(s) 70
BssMI GATC 1 cut(s) 47
Bst4CI ACNGT 2 cut(s) 71, 193
BstDEI CTNAG 1 cut(s) 15
BstDSI CCRYGG 1 cut(s) 70
BstKTI GATC 1 cut(s) 50
BstMBI GATC 1 cut(s) 47
BstMCI CGRYCG 1 cut(s) 50
BstSFI CTRYAG 1 cut(s) 118
BstV1I GCAGC 1 cut(s) 196
BtgI CCRYGG 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 127
CviJI RGCY 3 cut(s) 56, 106, 209
CviKI_1 RGCY 3 cut(s) 56, 106, 209
DdeI CTNAG 1 cut(s) 15
DpnI GATC 1 cut(s) 49
DpnII GATC 1 cut(s) 47
Eco47I GGWCC 1 cut(s) 127
FaiI YATR 2 cut(s) 9, 186
Fnu4HI GCNGC 3 cut(s) 54, 104, 210
Fsp4HI GCNGC 3 cut(s) 54, 104, 210
GluI GCNGC 3 cut(s) 54, 104, 210
HincII GTYRAC 1 cut(s) 196
HindII GTYRAC 1 cut(s) 196
HinfI GANTC 3 cut(s) 83, 179, 217
HphI GGTGA 1 cut(s) 158
Hpy166II GTNNAC 2 cut(s) 130, 196
Hpy188I TCNGA 1 cut(s) 88
Hpy8I GTNNAC 2 cut(s) 130, 196
HpyAV CCTTC 2 cut(s) 73, 136
HpyCH4III ACNGT 2 cut(s) 71, 193
HpyF3I CTNAG 1 cut(s) 15
Kzo9I GATC 1 cut(s) 47
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 2 cut(s) 84, 106
Lsp1109I GCAGC 1 cut(s) 196
MalI GATC 1 cut(s) 49
MboI GATC 1 cut(s) 47
MhlI GDGCHC 1 cut(s) 93
MluCI AATT 2 cut(s) 10, 152
MlyI GAGTC 2 cut(s) 92, 188
MmeI TCCRAC 1 cut(s) 66
MnlI CCTC 2 cut(s) 39, 142
MseI TTAA 2 cut(s) 39, 229
NdeII GATC 1 cut(s) 47
PfeI GAWTC 1 cut(s) 217
PkrI GCNGC 3 cut(s) 55, 105, 211
Ple19I CGATCG 1 cut(s) 50
PleI GAGTC 2 cut(s) 91, 187
PpsI GAGTC 2 cut(s) 91, 187
PshBI ATTAAT 1 cut(s) 39
PspPI GGNCC 1 cut(s) 127
PvuI CGATCG 1 cut(s) 50
SaqAI TTAA 2 cut(s) 39, 229
SatI GCNGC 3 cut(s) 54, 104, 210
Sau3AI GATC 1 cut(s) 47
Sau96I GGNCC 1 cut(s) 127
SchI GAGTC 2 cut(s) 92, 188
SduI GDGCHC 1 cut(s) 93
SetI ASST 2 cut(s) 112, 211
SfcI CTRYAG 1 cut(s) 118
SgeI CNNG 7 cut(s) 57, 73, 83, 111, 133, 170, 226
SinI GGWCC 1 cut(s) 127
Sse9I AATT 2 cut(s) 10, 152
SsiI CCGC 2 cut(s) 53, 103
TaaI ACNGT 2 cut(s) 71, 193
TasI AATT 2 cut(s) 10, 152
TauI GCSGC 2 cut(s) 56, 106
TfiI GAWTC 1 cut(s) 217
Tru1I TTAA 2 cut(s) 39, 229
Tru9I TTAA 2 cut(s) 39, 229
TseI GCWGC 1 cut(s) 209
VpaK11BI GGWCC 1 cut(s) 127
VspI ATTAAT 1 cut(s) 39
XapI RAATTY 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.