FvH4_6g23101

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0000776
Physical Location & Seq
Forward (+)
16949221 .. 16950236
1016 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g23101.t1

Sequence Viewer

Length: 315 bp
ATGTTGACACACGATGTTGGCCACATTATACGGGATGAAATTTCCATGGTGGCTCCAACTTGGGGTGAGATTACCGATGATGAGCAGAAGAAGCTGCCTACTAAACTCTTTAGAAGATCGACTGCAAACAAGAGTAACCGGGACAAGAAGACGTTGCACCACCACACCGGGTCGAGGGCTTTCATCTACAATACGAAGGAATTGAAGGACAAGGGTGAACACCTCTATTTCATTAAAAGTTACTCACAGGCGTATGACGCAGGTCACAACCTCAAGACGCAGGTCACAACCTCAAAGCAGCTGAAAATGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

12.09

Weight (kDa)

9.7

Isoelectric Point (pI)

31.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 251, 271
AcoI YGGCCR 1 cut(s) 19
AcsI RAATTY 1 cut(s) 39
AfiI CCNNNNNNNGG 2 cut(s) 62, 174
AgsI TTSAA 1 cut(s) 205
AluBI AGCT 2 cut(s) 94, 301
AluI AGCT 2 cut(s) 94, 301
AoxI GGCC 1 cut(s) 19
ApeKI GCWGC 2 cut(s) 94, 298
ApoI RAATTY 1 cut(s) 39
AsuC2I CCSGG 2 cut(s) 140, 169
AsuHPI GGTGA 2 cut(s) 77, 227
BalI TGGCCA 1 cut(s) 21
BbsI GAAGAC 1 cut(s) 155
BbvI GCAGC 2 cut(s) 81, 310
BcnI CCSGG 2 cut(s) 140, 169
BfuAI ACCTGC 2 cut(s) 251, 271
BisI GCNGC 2 cut(s) 95, 299
BlsI GCNGC 2 cut(s) 96, 300
Bme1390I CCNGG 2 cut(s) 140, 169
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 2 cut(s) 140, 169
BoxI GACNNNNGTC 2 cut(s) 261, 281
BpiI GAAGAC 1 cut(s) 155
BpuEI CTTGAG 1 cut(s) 257
BpuMI CCSGG 2 cut(s) 140, 169
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 174
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 2 cut(s) 62, 174
BseXI GCAGC 2 cut(s) 81, 310
BshFI GGCC 1 cut(s) 21
BsiSI CCGG 2 cut(s) 139, 168
BslFI GGGAC 1 cut(s) 155
BslI CCNNNNNNNGG 2 cut(s) 62, 174
BsmFI GGGAC 1 cut(s) 155
BsnI GGCC 1 cut(s) 21
Bsp143I GATC 1 cut(s) 116
Bsp19I CCATGG 1 cut(s) 45
BspANI GGCC 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 54
BspMI ACCTGC 2 cut(s) 251, 271
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 1 cut(s) 116
BssT1I CCWWGG 1 cut(s) 45
BstDSI CCRYGG 1 cut(s) 45
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstMWI GCNNNNNNNGC 2 cut(s) 91, 257
BstPAI GACNNNNGTC 2 cut(s) 261, 281
BstSCI CCNGG 2 cut(s) 138, 167
BstV1I GCAGC 2 cut(s) 81, 310
BstV2I GAAGAC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 21
BtgI CCRYGG 1 cut(s) 45
BtsCI GGATG 1 cut(s) 40
BveI ACCTGC 2 cut(s) 251, 271
CseI GACGC 2 cut(s) 266, 286
CviAII CATG 1 cut(s) 46
CviJI RGCY 5 cut(s) 21, 53, 94, 179, 301
CviKI_1 RGCY 5 cut(s) 21, 53, 94, 179, 301
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
EaeI YGGCCR 1 cut(s) 19
Eco130I CCWWGG 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 1 cut(s) 49
FaiI YATR 3 cut(s) 29, 47, 255
FaqI GGGAC 1 cut(s) 155
FatI CATG 1 cut(s) 45
Fnu4HI GCNGC 2 cut(s) 95, 299
FokI GGATG 1 cut(s) 47
Fsp4HI GCNGC 2 cut(s) 95, 299
GluI GCNGC 2 cut(s) 95, 299
HaeIII GGCC 1 cut(s) 21
HapII CCGG 2 cut(s) 139, 168
HgaI GACGC 2 cut(s) 266, 286
Hin1II CATG 1 cut(s) 49
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HpaII CCGG 2 cut(s) 139, 168
HphI GGTGA 2 cut(s) 77, 227
Hpy166II GTNNAC 2 cut(s) 6, 218
Hpy188III TCNNGA 1 cut(s) 274
Hpy8I GTNNAC 2 cut(s) 6, 218
HpyAV CCTTC 2 cut(s) 190, 199
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 2 cut(s) 125, 157
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 257
HpySE526I ACGT 1 cut(s) 152
Hsp92II CATG 1 cut(s) 49
Kzo9I GATC 1 cut(s) 116
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 5 cut(s) 152, 181, 233, 246, 266
Lsp1109I GCAGC 2 cut(s) 81, 310
MaeII ACGT 1 cut(s) 152
MaeIII GTNAC 4 cut(s) 134, 239, 263, 283
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 3 cut(s) 100, 126, 160
MlsI TGGCCA 1 cut(s) 21
MluCI AATT 2 cut(s) 39, 200
MluNI TGGCCA 1 cut(s) 21
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 4 cut(s) 168, 233, 281, 301
Mox20I TGGCCA 1 cut(s) 21
MscI TGGCCA 1 cut(s) 21
MseI TTAA 1 cut(s) 234
Msp20I TGGCCA 1 cut(s) 21
MspA1I CMGCKG 1 cut(s) 301
MspI CCGG 2 cut(s) 139, 168
MspR9I CCNGG 2 cut(s) 140, 169
MwoI GCNNNNNNNGC 2 cut(s) 91, 257
NciI CCSGG 2 cut(s) 140, 169
NcoI CCATGG 1 cut(s) 45
NdeII GATC 1 cut(s) 116
NlaIII CATG 1 cut(s) 49
NlaIV GGNNCC 1 cut(s) 54
NmuCI GTSAC 2 cut(s) 263, 283
PkrI GCNGC 2 cut(s) 96, 300
PshAI GACNNNNGTC 2 cut(s) 261, 281
PspN4I GGNNCC 1 cut(s) 54
PvuII CAGCTG 1 cut(s) 301
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 2 cut(s) 95, 299
Sau3AI GATC 1 cut(s) 116
ScrFI CCNGG 2 cut(s) 140, 169
SetI ASST 8 cut(s) 96, 155, 225, 265, 273, 285, 293, 303
SmlI CTYRAG 1 cut(s) 272
SmoI CTYRAG 1 cut(s) 272
Sse9I AATT 2 cut(s) 39, 200
StyD4I CCNGG 2 cut(s) 138, 167
StyI CCWWGG 1 cut(s) 45
TaiI ACGT 1 cut(s) 155
TaqI TCGA 2 cut(s) 119, 173
TasI AATT 2 cut(s) 39, 200
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TseFI GTSAC 2 cut(s) 263, 283
TseI GCWGC 2 cut(s) 94, 298
Tsp45I GTSAC 2 cut(s) 263, 283
TspDTI ATGAA 3 cut(s) 51, 172, 220
XapI RAATTY 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.