FvH4_6g17190

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0000776
Physical Location & Seq
Forward (+)
11169559 .. 11169801
243 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g17190.t1

Sequence Viewer

Length: 243 bp
ATGACAGAGATAGTGGCTGCTAGAAAGGAGGCGGCTGAGGCACAAGAGAGGGCCGAAAAAGCCCTGAAGATTGCTGAGCAGTCTGCTACAGATGATCAAGTGTTGAAGTTGCAAATGGATCAAATCATGGCTCGAATAGGGCTACAGCCTATGTTTTCACCCTCGGTCCCAAGCCAACAACCTCGAGATGACGATGATGATAGGGGCCTTAACACTTCTTCGATTAGTTTAGGAAATCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.79

Weight (kDa)

4.5

Isoelectric Point (pI)

45.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 126
AcuI CTGAAG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 106
AlwI GGATC 1 cut(s) 126
Ama87I CYCGRG 1 cut(s) 183
AoxI GGCC 2 cut(s) 51, 205
ApeKI GCWGC 1 cut(s) 17
AspS9I GGNCC 3 cut(s) 51, 166, 205
AsuHPI GGTGA 1 cut(s) 150
AvaI CYCGRG 1 cut(s) 183
AvaII GGWCC 1 cut(s) 166
BbvCI CCTCAGC 1 cut(s) 36
BbvI GCAGC 1 cut(s) 4
BclI TGATCA 1 cut(s) 94
BfaI CTAG 1 cut(s) 21
BfmI CTRYAG 2 cut(s) 87, 143
BisI GCNGC 2 cut(s) 18, 33
BlpI GCTNAGC 1 cut(s) 75
BlsI GCNGC 2 cut(s) 19, 34
Bme18I GGWCC 1 cut(s) 166
BmeT110I CYCGRG 1 cut(s) 183
BmgT120I GGNCC 3 cut(s) 51, 166, 205
BmiI GGNNCC 2 cut(s) 168, 206
Bpu10I CCTNAGC 1 cut(s) 36
Bpu1102I GCTNAGC 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 162
BseMII CTCAG 2 cut(s) 27, 66
BseXI GCAGC 1 cut(s) 4
BshFI GGCC 2 cut(s) 53, 207
BsiHKCI CYCGRG 1 cut(s) 183
BslFI GGGAC 1 cut(s) 152
BsmFI GGGAC 1 cut(s) 152
BsnI GGCC 2 cut(s) 53, 207
BsoBI CYCGRG 1 cut(s) 183
Bsp143I GATC 2 cut(s) 94, 118
Bsp1720I GCTNAGC 1 cut(s) 75
BspACI CCGC 1 cut(s) 32
BspANI GGCC 2 cut(s) 53, 207
BspCNI CTCAG 2 cut(s) 28, 67
BspLI GGNNCC 2 cut(s) 168, 206
BspPI GGATC 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 162
BssMI GATC 2 cut(s) 94, 118
BstDEI CTNAG 2 cut(s) 36, 75
BstKTI GATC 2 cut(s) 97, 121
BstMBI GATC 2 cut(s) 94, 118
BstMWI GCNNNNNNNGC 2 cut(s) 38, 59
BstSFI CTRYAG 2 cut(s) 87, 143
BstV1I GCAGC 1 cut(s) 4
BsuRI GGCC 2 cut(s) 53, 207
Cfr13I GGNCC 3 cut(s) 51, 166, 205
CviAII CATG 1 cut(s) 127
CviJI RGCY 9 cut(s) 17, 35, 53, 62, 131, 142, 148, 174, 207
CviKI_1 RGCY 9 cut(s) 17, 35, 53, 62, 131, 142, 148, 174, 207
DdeI CTNAG 2 cut(s) 36, 75
DpnI GATC 2 cut(s) 96, 120
DpnII GATC 2 cut(s) 94, 118
Eco47I GGWCC 1 cut(s) 166
Eco57I CTGAAG 1 cut(s) 86
Eco88I CYCGRG 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 205
FaeI CATG 1 cut(s) 130
FaiI YATR 2 cut(s) 128, 152
FaqI GGGAC 1 cut(s) 152
FatI CATG 1 cut(s) 126
FbaI TGATCA 1 cut(s) 94
Fnu4HI GCNGC 2 cut(s) 18, 33
Fsp4HI GCNGC 2 cut(s) 18, 33
FspBI CTAG 1 cut(s) 21
GluI GCNGC 2 cut(s) 18, 33
HaeIII GGCC 2 cut(s) 53, 207
Hin1II CATG 1 cut(s) 130
HphI GGTGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 185
HpyCH4V TGCA 1 cut(s) 112
HpyF10VI GCNNNNNNNGC 2 cut(s) 38, 59
HpyF3I CTNAG 2 cut(s) 36, 75
Hsp92II CATG 1 cut(s) 130
Ksp22I TGATCA 1 cut(s) 94
Kzo9I GATC 2 cut(s) 94, 118
LpnPI CCDG 1 cut(s) 77
Lsp1109I GCAGC 1 cut(s) 4
MaeI CTAG 1 cut(s) 21
MalI GATC 2 cut(s) 96, 120
MboI GATC 2 cut(s) 94, 118
MboII GAAGA 2 cut(s) 79, 210
MnlI CCTC 5 cut(s) 22, 31, 42, 172, 192
MseI TTAA 1 cut(s) 210
MwoI GCNNNNNNNGC 2 cut(s) 38, 59
NdeII GATC 2 cut(s) 94, 118
NlaIII CATG 1 cut(s) 130
NlaIV GGNNCC 2 cut(s) 168, 206
PaeR7I CTCGAG 1 cut(s) 183
PkrI GCNGC 2 cut(s) 19, 34
PspN4I GGNNCC 2 cut(s) 168, 206
PspPI GGNCC 3 cut(s) 51, 166, 205
SaqAI TTAA 1 cut(s) 210
SatI GCNGC 2 cut(s) 18, 33
Sau3AI GATC 2 cut(s) 94, 118
Sau96I GGNCC 3 cut(s) 51, 166, 205
SetI ASST 1 cut(s) 184
SfcI CTRYAG 2 cut(s) 87, 143
Sfr274I CTCGAG 1 cut(s) 183
SinI GGWCC 1 cut(s) 166
SlaI CTCGAG 1 cut(s) 183
SmlI CTYRAG 1 cut(s) 183
SmoI CTYRAG 1 cut(s) 183
SsiI CCGC 1 cut(s) 32
SspMI CTAG 1 cut(s) 21
TaqI TCGA 3 cut(s) 133, 184, 221
TaqII GACCGA 1 cut(s) 154
TauI GCSGC 1 cut(s) 35
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TseI GCWGC 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 166
XhoI CTCGAG 1 cut(s) 183
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.