Rmu_sc0000144.1_g000055

WAT1-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000144.1
OG0000337
Physical Location & Seq
Forward (+)
246502 .. 249655
3154 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000144.1_g000055.1.cds

Sequence Viewer

Length: 954 bp
atggggcagcagggtggtattgagatttctagcagtcctagtagtgtagtggatggattaatgaagccagtgataacgatggtggcagctcagattgcatatgcagcaacgggtattttctacaaacttgcagcagactctggaatgaacctcaatattctcgttgcctaccgtctcatgttttcctctgccattatcgttcctcttgctcttatactcgaaaggggatcattgtcacaaaatttattcatcgagggactggccttaacatcaccgacatttgttgcagccactgcaaatctgattccggcggttaccttgatcatggccatctgttttaggttggagaagttgacactaggaagccatgcagggaaggcaaagcttgtggggacagtggtaggtattggtggtgctatgatctttaccttcttcaaaggaccagagttctccatctggtcaactcacgttgaccttcttcgaggactccacgcggcaccatcaccgtcatcggtctcgttacacagaagcaccggtagtcacttgctgggctccttctcggctctcggcagcgccgtttcctatgcaatgtggctcacagttcagggaaaaatgagcaagagatatccatgcccttactcgagcacagctctaatgtcagtgatgggatcgattcagtcggtagcttttgcactctgcgtggagagggattggagccagtggaaattgggttggaacatcaagcttctcacagctgcatatacgagcagcgaaataccggttcgattacgtcgttattttcataaccatatcgacatcgaggttggagctcttggttctgatgaagtctggaggttcacgggtatctacggctttgcctccaatggggatcgagtccgtacctggggatttactgaggattttggctgcacaatcctctctcaaggttggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0008150 GO:0016020 GO:0022857 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EamA

Protein Analysis

317

Amino Acids

34.16

Weight (kDa)

9.05

Isoelectric Point (pI)

46.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000337)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G25270 AT1G68170 AT1G68170
fragaria_vesca FvH4_5g30250 FvH4_5g30250 FvH4_5g30280 FvH4_5g30370 FvH4_5g30371 FvH4_7g27400 FvH4_7g27400 FvH4_7g27430
malus_domestica MD08G1223600.v1.1 MD08G1224100.v1.1 MD08G1224300.v1.1 MD08G1224400.v1.1 MD08G1224500.v1.1 MD11G1289900.v1.1 MD11G1290000.v1.1 MD15G1417300.v1.1 MD15G1417400.v1.1 MD15G1417500.v1.1 MD17G1230500.v1.1
prunus_persica Prupe.1G561200_v2.0.a1 Prupe.1G561300_v2.0.a1 Prupe.1G561400_v2.0.a1 Prupe.1G561500_v2.0.a1 Prupe.7G041900_v2.0.a1 Prupe.7G041900_v2.0.a1 Prupe.7G041900_v2.0.a1 Prupe.7G042100_v2.0.a1
pyrus_communis pycom08g19530 pycom15g37030 pycom15g37040 pycom17g23340
rosa_chinensis RchiOBHm_Chr1g0374241 RchiOBHm_Chr7g0224261 RchiOBHm_Chr7g0224561 RchiOBHm_Chr7g0224591 RchiOBHm_Chr7g0224611 RchiOBHm_Chr7g0224641 RchiOBHm_Chr7g0224801 RchiOBHm_Chr7g0224831
rosa_laevigata RLG00000001850 RLG00000001853 RLG00000001869 RLG00000001876 RLG00000001880 RLG00000001884 RLG00000001909 RLG00000026752
rosa_multiflora Rmu_co8280549.1_g000001 Rmu_co8423019.1_g000001 Rmu_co8464247.1_g000001 Rmu_sc0000144.1_g000002 Rmu_sc0000144.1_g000055 Rmu_sc0007613.1_g000002 Rmu_sc0008008.1_g000015 Rmu_sc0010368.1_g000011 Rmu_sc0010368.1_g000019
rosa_roxburghii Rroxscaffold_3G00234350 Rroxscaffold_3G00234370 Rroxscaffold_3G00234560 Rroxscaffold_3G00234570 Rroxscaffold_3G00234590 Rroxscaffold_3G00234630 Rroxscaffold_4G00316910
rosa_rugosa Rorug01G0381800 Rorug07G0221700 Rorug07G0223900 Rorug07G0224000 Rorug07G0224100 Rorug07G0224200 Rorug07G0224500 Rorug07G0225900 Rorug07G0225900 Rorug07G0226100 Rorug07G0226100 Rorug07G0226200 Rorug07G0226300
rosa_samantha Rh1AG392800 Rh1BG356900 Rh1CG369900 Rh1DG387400 Rh7AG366800 Rh7AG377200 Rh7AG377300 Rh7AG378400 Rh7AG378600 Rh7AG378700 Rh7CG385300 Rh7CG395900 Rh7CG396000 Rh7CG397700 Rh7CG398000 Rh7CG398200 Rh7CG398300 Rh7DG360700 Rh7DG369900 Rh7DG370300 Rh7DG370500 Rh7DG370800 Rh7DG371600 Rh7DG371700
rosa_wichuraiana Rw1G034300 Rw7G031030 Rw7G031250 Rw7G031260 Rw7G031270 Rw7G031290 Rw7G031370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 496
AccII CGCG 1 cut(s) 494
AciI CCGC 2 cut(s) 311, 494
AclWI GGATC 3 cut(s) 235, 676, 897
AcoI YGGCCR 1 cut(s) 327
AcsI RAATTY 1 cut(s) 241
AfaI GTAC 1 cut(s) 901
AfiI CCNNNNNNNGG 2 cut(s) 885, 904
AgeI ACCGGT 2 cut(s) 533, 778
AgsI TTSAA 1 cut(s) 436
AjnI CCWGG 1 cut(s) 902
AluBI AGCT 7 cut(s) 89, 385, 650, 686, 745, 755, 830
AluI AGCT 7 cut(s) 89, 385, 650, 686, 745, 755, 830
Alw21I GWGCWC 2 cut(s) 647, 832
Alw26I GTCTC 2 cut(s) 179, 520
AlwI GGATC 3 cut(s) 235, 676, 897
AlwNI CAGNNNCTG 2 cut(s) 140, 293
Ama87I CYCGRG 1 cut(s) 640
AoxI GGCC 2 cut(s) 261, 327
ApeKI GCWGC 9 cut(s) 7, 86, 104, 131, 287, 570, 755, 768, 927
ApoI RAATTY 1 cut(s) 241
AseI ATTAAT 1 cut(s) 59
AsiGI ACCGGT 2 cut(s) 533, 778
AspLEI GCGC 1 cut(s) 575
AspS9I GGNCC 1 cut(s) 440
AsuHPI GGTGA 2 cut(s) 264, 495
AvaI CYCGRG 1 cut(s) 640
AvaII GGWCC 1 cut(s) 440
BalI TGGCCA 1 cut(s) 329
BanI GGYRCC 1 cut(s) 496
BanII GRGCYC 2 cut(s) 554, 832
Bbv12I GWGCWC 2 cut(s) 647, 832
BbvI GCAGC 9 cut(s) 19, 98, 116, 143, 299, 582, 742, 780, 914
BccI CCATC 6 cut(s) 47, 73, 338, 461, 508, 658
BceAI ACGGC 2 cut(s) 560, 886
BciT130I CCWGG 1 cut(s) 904
BclI TGATCA 1 cut(s) 321
BcoDI GTCTC 2 cut(s) 179, 520
BfaI CTAG 3 cut(s) 30, 39, 359
BfoI RGCGCY 1 cut(s) 576
Bme1390I CCNGG 1 cut(s) 904
Bme18I GGWCC 1 cut(s) 440
BmeT110I CYCGRG 1 cut(s) 640
BmgT120I GGNCC 1 cut(s) 440
BmiI GGNNCC 3 cut(s) 498, 553, 716
BmrFI CCNGG 1 cut(s) 904
BplI GAGNNNNNCTC 2 cut(s) 634, 666
BpmI CTGGAG 1 cut(s) 871
BpuEI CTTGAG 1 cut(s) 927
Bsa29I ATCGAT 1 cut(s) 671
BsaI GGTCTC 1 cut(s) 520
BsaJI CCNNGG 1 cut(s) 903
BsaWI WCCGGW 2 cut(s) 533, 778
Bsc4I CCNNNNNNNGG 2 cut(s) 885, 904
Bse118I RCCGGY 2 cut(s) 533, 778
Bse1I ACTGG 3 cut(s) 68, 264, 718
Bse3DI GCAATG 1 cut(s) 594
BseBI CCWGG 1 cut(s) 904
BseCI ATCGAT 1 cut(s) 671
BseDI CCNNGG 1 cut(s) 903
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 2 cut(s) 885, 904
BseMI GCAATG 1 cut(s) 594
BseMII CTCAG 2 cut(s) 104, 906
BseNI ACTGG 3 cut(s) 68, 264, 718
BseXI GCAGC 9 cut(s) 19, 98, 116, 143, 299, 582, 742, 780, 914
BseYI CCCAGC 1 cut(s) 547
BsgI GTGCAG 1 cut(s) 913
Bsh1236I CGCG 1 cut(s) 494
BshFI GGCC 2 cut(s) 263, 329
BshNI GGYRCC 1 cut(s) 496
BshTI ACCGGT 2 cut(s) 533, 778
BshVI ATCGAT 1 cut(s) 671
BsiHKAI GWGCWC 2 cut(s) 647, 832
BsiHKCI CYCGRG 1 cut(s) 640
BsiSI CCGG 3 cut(s) 308, 534, 779
BslFI GGGAC 2 cut(s) 270, 406
BslI CCNNNNNNNGG 2 cut(s) 885, 904
BsmAI GTCTC 2 cut(s) 179, 520
BsmBI CGTCTC 1 cut(s) 179
BsmFI GGGAC 2 cut(s) 270, 406
BsnI GGCC 2 cut(s) 263, 329
Bso31I GGTCTC 1 cut(s) 520
BsoBI CYCGRG 1 cut(s) 640
Bsp1286I GDGCHC 3 cut(s) 554, 647, 832
Bsp143I GATC 5 cut(s) 227, 321, 420, 668, 889
BspACI CCGC 2 cut(s) 311, 494
BspANI GGCC 2 cut(s) 263, 329
BspCNI CTCAG 2 cut(s) 103, 907
BspDI ATCGAT 1 cut(s) 671
BspFNI CGCG 1 cut(s) 494
BspLI GGNNCC 3 cut(s) 498, 553, 716
BspPI GGATC 3 cut(s) 235, 676, 897
BspT107I GGYRCC 1 cut(s) 496
BspTNI GGTCTC 1 cut(s) 520
BsrDI GCAATG 1 cut(s) 594
BsrFI RCCGGY 2 cut(s) 533, 778
BsrI ACTGG 3 cut(s) 68, 264, 718
BssAI RCCGGY 2 cut(s) 533, 778
BssECI CCNNGG 1 cut(s) 903
BssMI GATC 5 cut(s) 227, 321, 420, 668, 889
Bst2UI CCWGG 1 cut(s) 904
Bst4CI ACNGT 4 cut(s) 173, 397, 507, 601
BstAPI GCANNNNNTGC 1 cut(s) 293
BstDEI CTNAG 2 cut(s) 90, 915
BstEII GGTNACC 1 cut(s) 313
BstF5I GGATG 1 cut(s) 58
BstFNI CGCG 1 cut(s) 494
BstH2I RGCGCY 1 cut(s) 576
BstHHI GCGC 1 cut(s) 575
BstKTI GATC 5 cut(s) 230, 324, 423, 671, 892
BstMAI GTCTC 2 cut(s) 179, 520
BstMBI GATC 5 cut(s) 227, 321, 420, 668, 889
BstMWI GCNNNNNNNGC 4 cut(s) 95, 104, 293, 377
BstNI CCWGG 1 cut(s) 904
BstPI GGTNACC 1 cut(s) 313
BstSCI CCNGG 1 cut(s) 902
BstUI CGCG 1 cut(s) 494
BstV1I GCAGC 9 cut(s) 19, 98, 116, 143, 299, 582, 742, 780, 914
Bsu15I ATCGAT 1 cut(s) 671
BsuRI GGCC 2 cut(s) 263, 329
BsuTUI ATCGAT 1 cut(s) 671
BtsCI GGATG 1 cut(s) 58
BtsI GCAGTG 1 cut(s) 291
BtsIMutI CAGTG 5 cut(s) 75, 291, 402, 666, 725
CaiI CAGNNNCTG 2 cut(s) 140, 293
CfoI GCGC 1 cut(s) 575
Cfr10I RCCGGY 2 cut(s) 533, 778
Cfr13I GGNCC 1 cut(s) 440
ClaI ATCGAT 1 cut(s) 671
Csp6I GTAC 1 cut(s) 900
CspAI ACCGGT 2 cut(s) 533, 778
CspCI CAANNNNNGTGG 2 cut(s) 369, 404
CviAII CATG 4 cut(s) 178, 325, 368, 630
CviQI GTAC 1 cut(s) 900
DdeI CTNAG 2 cut(s) 90, 915
DpnI GATC 5 cut(s) 229, 323, 422, 670, 891
DpnII GATC 5 cut(s) 227, 321, 420, 668, 889
EaeI YGGCCR 1 cut(s) 327
Ecl136II GAGCTC 1 cut(s) 830
Eco24I GRGCYC 2 cut(s) 554, 832
Eco31I GGTCTC 1 cut(s) 520
Eco32I GATATC 1 cut(s) 626
Eco47I GGWCC 1 cut(s) 440
Eco53kI GAGCTC 1 cut(s) 830
Eco88I CYCGRG 1 cut(s) 640
Eco91I GGTNACC 1 cut(s) 313
EcoICRI GAGCTC 1 cut(s) 830
EcoO65I GGTNACC 1 cut(s) 313
EcoRII CCWGG 1 cut(s) 902
EcoRV GATATC 1 cut(s) 626
EcoT38I GRGCYC 2 cut(s) 554, 832
Esp3I CGTCTC 1 cut(s) 179
FaeI CATG 4 cut(s) 181, 328, 371, 633
FaqI GGGAC 2 cut(s) 270, 406
FatI CATG 4 cut(s) 177, 324, 367, 629
FauNDI CATATG 1 cut(s) 100
FbaI TGATCA 1 cut(s) 321
FokI GGATG 1 cut(s) 65
FriOI GRGCYC 2 cut(s) 554, 832
FspBI CTAG 3 cut(s) 30, 39, 359
GlaI GCGC 1 cut(s) 574
GsaI CCCAGC 1 cut(s) 551
GsuI CTGGAG 1 cut(s) 871
HaeII RGCGCY 1 cut(s) 576
HaeIII GGCC 2 cut(s) 263, 329
HapII CCGG 3 cut(s) 308, 534, 779
HhaI GCGC 1 cut(s) 575
Hin1II CATG 4 cut(s) 181, 328, 371, 633
Hin6I GCGC 1 cut(s) 573
HinP1I GCGC 1 cut(s) 573
HincII GTYRAC 3 cut(s) 354, 462, 472
HindII GTYRAC 3 cut(s) 354, 462, 472
HindIII AAGCTT 2 cut(s) 383, 743
HinfI GANTC 5 cut(s) 137, 304, 486, 673, 894
HpaII CCGG 3 cut(s) 308, 534, 779
HphI GGTGA 2 cut(s) 264, 495
Hpy166II GTNNAC 4 cut(s) 354, 462, 472, 858
Hpy188I TCNGA 3 cut(s) 93, 303, 841
Hpy188III TCNNGA 2 cut(s) 141, 850
Hpy8I GTNNAC 4 cut(s) 354, 462, 472, 858
Hpy99I CGWCG 1 cut(s) 795
HpyAV CCTTC 4 cut(s) 370, 439, 485, 565
HpyCH4III ACNGT 4 cut(s) 173, 397, 507, 601
HpyCH4IV ACGT 2 cut(s) 468, 790
HpyF10VI GCNNNNNNNGC 4 cut(s) 95, 104, 293, 377
HpyF3I CTNAG 2 cut(s) 90, 915
HpySE526I ACGT 2 cut(s) 468, 790
Hsp92II CATG 4 cut(s) 181, 328, 371, 633
HspAI GCGC 1 cut(s) 573
Ksp22I TGATCA 1 cut(s) 321
Kzo9I GATC 5 cut(s) 227, 321, 420, 668, 889
LmnI GCTCC 3 cut(s) 557, 714, 827
Lsp1109I GCAGC 9 cut(s) 19, 98, 116, 143, 299, 582, 742, 780, 914
MaeI CTAG 3 cut(s) 30, 39, 359
MaeII ACGT 2 cut(s) 468, 790
MaeIII GTNAC 4 cut(s) 234, 313, 519, 539
MalI GATC 5 cut(s) 229, 323, 422, 670, 891
MboI GATC 5 cut(s) 227, 321, 420, 668, 889
MboII GAAGA 2 cut(s) 424, 470
MhlI GDGCHC 3 cut(s) 554, 647, 832
MlsI TGGCCA 1 cut(s) 329
MluCI AATT 2 cut(s) 241, 725
MluNI TGGCCA 1 cut(s) 329
MlyI GAGTC 3 cut(s) 131, 480, 903
MmeI TCCRAC 3 cut(s) 324, 713, 805
Mox20I TGGCCA 1 cut(s) 329
MscI TGGCCA 1 cut(s) 329
MseI TTAA 2 cut(s) 59, 266
Msp20I TGGCCA 1 cut(s) 329
MspA1I CMGCKG 1 cut(s) 755
MspI CCGG 3 cut(s) 308, 534, 779
MspR9I CCNGG 1 cut(s) 904
MvaI CCWGG 1 cut(s) 904
MvnI CGCG 1 cut(s) 494
MwoI GCNNNNNNNGC 4 cut(s) 95, 104, 293, 377
NdeI CATATG 1 cut(s) 100
NdeII GATC 5 cut(s) 227, 321, 420, 668, 889
NlaIII CATG 4 cut(s) 181, 328, 371, 633
NlaIV GGNNCC 3 cut(s) 498, 553, 716
NmeAIII GCCGAG 2 cut(s) 539, 546
NmuCI GTSAC 2 cut(s) 234, 539
PaeR7I CTCGAG 1 cut(s) 640
PcsI WCGNNNNNNNCGW 2 cut(s) 573, 790
PfeI GAWTC 2 cut(s) 304, 673
PinAI ACCGGT 2 cut(s) 533, 778
PleI GAGTC 3 cut(s) 131, 480, 902
PpsI GAGTC 3 cut(s) 131, 480, 902
PshBI ATTAAT 1 cut(s) 59
Psp124BI GAGCTC 1 cut(s) 832
Psp6I CCWGG 1 cut(s) 902
PspEI GGTNACC 1 cut(s) 313
PspFI CCCAGC 1 cut(s) 547
PspGI CCWGG 1 cut(s) 902
PspN4I GGNNCC 3 cut(s) 498, 553, 716
PspPI GGNCC 1 cut(s) 440
PspXI VCTCGAGB 1 cut(s) 640
PstNI CAGNNNCTG 2 cut(s) 140, 293
PvuII CAGCTG 1 cut(s) 755
RsaI GTAC 1 cut(s) 901
RsaNI GTAC 1 cut(s) 900
SacI GAGCTC 1 cut(s) 832
SaqAI TTAA 2 cut(s) 59, 266
Sau3AI GATC 5 cut(s) 227, 321, 420, 668, 889
Sau96I GGNCC 1 cut(s) 440
SchI GAGTC 3 cut(s) 131, 480, 903
ScrFI CCNGG 1 cut(s) 904
SduI GDGCHC 3 cut(s) 554, 647, 832
Sfr274I CTCGAG 1 cut(s) 640
SinI GGWCC 1 cut(s) 440
SlaI CTCGAG 1 cut(s) 640
SmlI CTYRAG 2 cut(s) 640, 942
SmoI CTYRAG 2 cut(s) 640, 942
Sse9I AATT 2 cut(s) 241, 725
SsiI CCGC 2 cut(s) 311, 494
SspI AATATT 1 cut(s) 157
SspMI CTAG 3 cut(s) 30, 39, 359
SstI GAGCTC 1 cut(s) 832
StyD4I CCNGG 1 cut(s) 902
TaaI ACNGT 4 cut(s) 173, 397, 507, 601
TaiI ACGT 2 cut(s) 471, 793
TaqI TCGA 9 cut(s) 219, 252, 481, 641, 671, 784, 813, 819, 892
TaqII GACCGA 1 cut(s) 502
TasI AATT 2 cut(s) 241, 725
TauI GCSGC 1 cut(s) 497
TfiI GAWTC 2 cut(s) 304, 673
Tru1I TTAA 2 cut(s) 59, 266
Tru9I TTAA 2 cut(s) 59, 266
TscAI CASTG 5 cut(s) 75, 298, 402, 666, 725
TseFI GTSAC 2 cut(s) 234, 539
TseI GCWGC 9 cut(s) 7, 86, 104, 131, 287, 570, 755, 768, 927
Tsp45I GTSAC 2 cut(s) 234, 539
TspDTI ATGAA 5 cut(s) 77, 161, 238, 791, 858
TspGWI ACGGA 1 cut(s) 887
TspRI CASTG 5 cut(s) 75, 298, 402, 666, 725
VpaK11BI GGWCC 1 cut(s) 440
VspI ATTAAT 1 cut(s) 59
XapI RAATTY 1 cut(s) 241
XhoI CTCGAG 1 cut(s) 640
XspI CTAG 3 cut(s) 30, 39, 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.