Rmu_sc0002715.1_g000007

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002715.1
OG0000619
Physical Location & Seq
Forward (+)
22508 .. 22969
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002715.1_g000007.1.cds

Sequence Viewer

Length: 384 bp
atgatggcctttcaggatactctgaacttttgtgaattggaggatatcaggtttacgggacctaggtttacctggaaaggcacgagaaatggcgaagaggtgaaaattaggttggatcggtttacgggtaatcagaattggaagagtatgtttcctgcatcttcagcgaagcacttgaaccagtcgacgttggaccacatccctattatcttggaggagacgtgtcgagaggtggttaaaagtggttgggagggtgtcacggggtctaatcccttcctgaagttgtgcaacagaactcagaatactaggaggctacttgaagcgtggagttctgatcagtttgggtctttaactaaagagattgagttgaccaggctcaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1

Protein Analysis

127

Amino Acids

14.71

Weight (kDa)

7.74

Isoelectric Point (pI)

28.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000619)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29861 FvH4_3g26084 FvH4_3g32551 FvH4_4g08193 FvH4_4g12950 FvH4_6g29733
rosa_chinensis RchiOBHm_Chr3g0488921
rosa_multiflora Rmu_co8238041.1_g000001 Rmu_co8265215.1_g000001 Rmu_co8486357.1_g000002 Rmu_sc0000389.1_g000016 Rmu_sc0000580.1_g000123 Rmu_sc0000789.1_g000005 Rmu_sc0001043.1_g000006 Rmu_sc0001208.1_g000001 Rmu_sc0001323.1_g000011 Rmu_sc0001636.1_g000001 Rmu_sc0001911.1_g000023 Rmu_sc0001940.1_g000010 Rmu_sc0002531.1_g000047 Rmu_sc0002715.1_g000007 Rmu_sc0002833.1_g000024 Rmu_sc0003859.1_g000046 Rmu_sc0003894.1_g000008 Rmu_sc0004744.1_g000008 Rmu_sc0004924.1_g000016 Rmu_sc0004991.1_g000004 Rmu_sc0005149.1_g000010 Rmu_sc0005149.1_g000011 Rmu_sc0005489.1_g000007 Rmu_sc0005592.1_g000030 Rmu_sc0005813.1_g000010 Rmu_sc0005813.1_g000011 Rmu_sc0005861.1_g000009 Rmu_sc0005949.1_g000016 Rmu_sc0006824.1_g000021 Rmu_sc0007069.1_g000025 Rmu_sc0008002.1_g000008 Rmu_sc0008148.1_g000008 Rmu_sc0008280.1_g000001 Rmu_sc0008317.1_g000010 Rmu_sc0011615.1_g000002 Rmu_sc0013925.1_g000004 Rmu_sc0014130.1_g000003 Rmu_sc0014510.1_g000008 Rmu_sc0016640.1_g000001 Rmu_sc0018068.1_g000002 Rmu_sc0021371.1_g000006 Rmu_sc0028652.1_g000007 Rmu_sc0032187.1_g000002 Rmu_sc0034241.1_g000001 Rmu_ssc0000127.1_g000003
rosa_roxburghii Rroxscaffold_6G00403950
rosa_rugosa Rorug01G0081700 Rorug02G0544000 Rorug05G0089900 Rorug05G0284500 Rorug05G0452400 Rorug07G0003400 Rorug07G0003400 Rorug07G0129200 Rorug07G0210600
rosa_samantha Rh1AG193900 Rh1AG194000 Rh1DG063400 Rh1DG204700 Rh2AG364300 Rh3BG140200 Rh3CG366000 Rh4DG342600 Rh5AG347700 Rh5BG437300 Rh5CG459900 Rh5DG127400 Rh5DG412800 Rh6BG381500 Rh7CG520500 Rh7DG241900 Rh7DG336000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 185
AclWI GGATC 1 cut(s) 123
AcuI CTGAAG 2 cut(s) 147, 299
AflIII ACRYGT 1 cut(s) 221
AgsI TTSAA 2 cut(s) 178, 320
AjiI CACGTC 1 cut(s) 222
AjnI CCWGG 2 cut(s) 71, 371
AjuI GAANNNNNNNTTGG 2 cut(s) 95, 127
Alw26I GTCTC 1 cut(s) 212
AlwI GGATC 1 cut(s) 123
AoxI GGCC 1 cut(s) 6
AspA2I CCTAGG 1 cut(s) 62
AspS9I GGNCC 2 cut(s) 59, 193
AsuHPI GGTGA 1 cut(s) 112
AvaII GGWCC 2 cut(s) 59, 193
AvrII CCTAGG 1 cut(s) 62
BauI CACGAG 1 cut(s) 82
BciT130I CCWGG 2 cut(s) 73, 373
BciVI GTATCC 1 cut(s) 10
BclI TGATCA 1 cut(s) 334
BcoDI GTCTC 1 cut(s) 212
BfaI CTAG 3 cut(s) 63, 306, 382
BfuI GTATCC 1 cut(s) 10
BlnI CCTAGG 1 cut(s) 62
Bme1390I CCNGG 2 cut(s) 73, 373
Bme18I GGWCC 2 cut(s) 59, 193
BmgBI CACGTC 1 cut(s) 222
BmgT120I GGNCC 2 cut(s) 59, 193
BmiI GGNNCC 1 cut(s) 60
BmrFI CCNGG 2 cut(s) 73, 373
BmsI GCATC 1 cut(s) 167
BsaJI CCNNGG 1 cut(s) 62
BsaXI ACNNNNNCTCC 2 cut(s) 206, 236
Bse1I ACTGG 1 cut(s) 181
BseBI CCWGG 2 cut(s) 73, 373
BseDI CCNNGG 1 cut(s) 62
BseGI GGATG 1 cut(s) 198
BseMII CTCAG 1 cut(s) 311
BseNI ACTGG 1 cut(s) 181
BseRI GAGGAG 1 cut(s) 230
BshFI GGCC 1 cut(s) 8
BslFI GGGAC 1 cut(s) 72
BsmAI GTCTC 1 cut(s) 212
BsmBI CGTCTC 1 cut(s) 212
BsmFI GGGAC 1 cut(s) 72
BsnI GGCC 1 cut(s) 8
Bsp143I GATC 2 cut(s) 115, 334
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 310
BspLI GGNNCC 1 cut(s) 60
BspPI GGATC 1 cut(s) 123
BsrI ACTGG 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 62
BssMI GATC 2 cut(s) 115, 334
BssSI CACGAG 1 cut(s) 82
BssT1I CCWWGG 1 cut(s) 62
Bst2BI CACGAG 1 cut(s) 82
Bst2UI CCWGG 2 cut(s) 73, 373
Bst6I CTCTTC 2 cut(s) 90, 137
BstDEI CTNAG 1 cut(s) 297
BstF5I GGATG 1 cut(s) 198
BstKTI GATC 2 cut(s) 118, 337
BstMAI GTCTC 1 cut(s) 212
BstMBI GATC 2 cut(s) 115, 334
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstNI CCWGG 2 cut(s) 73, 373
BstSCI CCNGG 2 cut(s) 71, 371
BsuI GTATCC 1 cut(s) 10
BsuRI GGCC 1 cut(s) 8
BtrI CACGTC 1 cut(s) 222
BtsCI GGATG 1 cut(s) 198
Cfr13I GGNCC 2 cut(s) 59, 193
CviJI RGCY 3 cut(s) 8, 313, 376
CviKI_1 RGCY 3 cut(s) 8, 313, 376
DdeI CTNAG 1 cut(s) 297
DpnI GATC 2 cut(s) 117, 336
DpnII GATC 2 cut(s) 115, 334
Eam1104I CTCTTC 2 cut(s) 90, 137
EarI CTCTTC 2 cut(s) 90, 137
Eco130I CCWWGG 1 cut(s) 62
Eco32I GATATC 1 cut(s) 46
Eco47I GGWCC 2 cut(s) 59, 193
Eco57I CTGAAG 2 cut(s) 147, 299
EcoO109I RGGNCCY 1 cut(s) 59
EcoRII CCWGG 2 cut(s) 71, 371
EcoRV GATATC 1 cut(s) 46
EcoT14I CCWWGG 1 cut(s) 62
ErhI CCWWGG 1 cut(s) 62
Esp3I CGTCTC 1 cut(s) 212
FaiI YATR 1 cut(s) 149
FaqI GGGAC 1 cut(s) 72
FbaI TGATCA 1 cut(s) 334
FblI GTMKAC 1 cut(s) 185
FokI GGATG 1 cut(s) 185
FspBI CTAG 3 cut(s) 63, 306, 382
HaeIII GGCC 1 cut(s) 8
HincII GTYRAC 2 cut(s) 186, 369
HindII GTYRAC 2 cut(s) 186, 369
HphI GGTGA 1 cut(s) 112
Hpy166II GTNNAC 5 cut(s) 54, 69, 123, 186, 369
Hpy188I TCNGA 4 cut(s) 24, 135, 300, 334
Hpy188III TCNNGA 3 cut(s) 14, 227, 277
Hpy8I GTNNAC 5 cut(s) 54, 69, 123, 186, 369
Hpy99I CGWCG 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 283
HpyCH4IV ACGT 2 cut(s) 188, 221
HpyCH4V TGCA 2 cut(s) 158, 288
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
HpyF3I CTNAG 1 cut(s) 297
HpySE526I ACGT 2 cut(s) 188, 221
Ksp22I TGATCA 1 cut(s) 334
Kzo9I GATC 2 cut(s) 115, 334
LpnPI CCDG 7 cut(s) 34, 58, 85, 168, 194, 290, 358
LweI GCATC 1 cut(s) 167
MaeI CTAG 3 cut(s) 63, 306, 382
MaeII ACGT 2 cut(s) 188, 221
MaeIII GTNAC 1 cut(s) 256
MalI GATC 2 cut(s) 117, 336
MboI GATC 2 cut(s) 115, 334
MboII GAAGA 3 cut(s) 107, 153, 154
MluCI AATT 3 cut(s) 35, 105, 136
MmeI TCCRAC 2 cut(s) 93, 171
MnlI CCTC 6 cut(s) 34, 91, 208, 223, 244, 303
MseI TTAA 2 cut(s) 237, 350
MspR9I CCNGG 2 cut(s) 73, 373
MvaI CCWGG 2 cut(s) 73, 373
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeII GATC 2 cut(s) 115, 334
NlaIV GGNNCC 1 cut(s) 60
NmuCI GTSAC 1 cut(s) 256
PpuMI RGGWCCY 1 cut(s) 59
Psp5II RGGWCCY 1 cut(s) 59
Psp6I CCWGG 2 cut(s) 71, 371
PspGI CCWGG 2 cut(s) 71, 371
PspN4I GGNNCC 1 cut(s) 60
PspPI GGNCC 2 cut(s) 59, 193
PspPPI RGGWCCY 1 cut(s) 59
PsrI GAACNNNNNNTAC 2 cut(s) 286, 318
SalI GTCGAC 1 cut(s) 184
SaqAI TTAA 2 cut(s) 237, 350
Sau3AI GATC 2 cut(s) 115, 334
Sau96I GGNCC 2 cut(s) 59, 193
ScrFI CCNGG 2 cut(s) 73, 373
SetI ASST 9 cut(s) 53, 64, 68, 74, 102, 113, 191, 224, 234
SfaNI GCATC 1 cut(s) 167
SinI GGWCC 2 cut(s) 59, 193
Sse9I AATT 3 cut(s) 35, 105, 136
SspMI CTAG 3 cut(s) 63, 306, 382
StyD4I CCNGG 2 cut(s) 71, 371
StyI CCWWGG 1 cut(s) 62
TaiI ACGT 2 cut(s) 191, 224
TaqI TCGA 2 cut(s) 185, 226
TasI AATT 3 cut(s) 35, 105, 136
Tru1I TTAA 2 cut(s) 237, 350
Tru9I TTAA 2 cut(s) 237, 350
TseFI GTSAC 1 cut(s) 256
Tsp45I GTSAC 1 cut(s) 256
VpaK11BI GGWCC 2 cut(s) 59, 193
XmaJI CCTAGG 1 cut(s) 62
XmiI GTMKAC 1 cut(s) 185
XspI CTAG 3 cut(s) 63, 306, 382
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.