Rmu_sc0003859.1_g000046

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003859.1
OG0000619
Physical Location & Seq
Forward (+)
166301 .. 166924
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003859.1_g000046.1.cds

Sequence Viewer

Length: 624 bp
atgaatgtgttatgttcgaactgtcgggggattgggaacccctggacagtgacggggcttaaagggataatatccctaaatcatcccaatataatttttcttagtgagactttgtgtacggcggagaagatggttagtgtacggaatcagattgggtggaggcatgttgtagctgttaattgtaggttcgttaaaaaaaagaagggtaagggtgtgtgtacggcaggagggctttgtttactttggaatgatgaagtgaaggtggatctccaatcctattcggaaagtcatattgatgttactgttgggcgacatggggacccgaaaagttggagatttacgggactttatggacaaccgaaagctgaaaataggcaacggacttggaatttgttaagacatcttagcttgcaaggcaacctaccctgggtggttgcgggagactgcaatgagatctcgttggtttcaaacaaattaggaggtcctcgtcatagtgcttctcagctggcagggttgcaagaggctctggagttctgtgagtcaggagaatttaaagtggtgggtccgaaatttacttggaatggtatatggggaggtgaagtggtgaagattagattggattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

207

Amino Acids

22.93

Weight (kDa)

9.19

Isoelectric Point (pI)

30.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000619)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29861 FvH4_3g26084 FvH4_3g32551 FvH4_4g08193 FvH4_4g12950 FvH4_6g29733
rosa_chinensis RchiOBHm_Chr3g0488921
rosa_multiflora Rmu_co8238041.1_g000001 Rmu_co8265215.1_g000001 Rmu_co8486357.1_g000002 Rmu_sc0000389.1_g000016 Rmu_sc0000580.1_g000123 Rmu_sc0000789.1_g000005 Rmu_sc0001043.1_g000006 Rmu_sc0001208.1_g000001 Rmu_sc0001323.1_g000011 Rmu_sc0001636.1_g000001 Rmu_sc0001911.1_g000023 Rmu_sc0001940.1_g000010 Rmu_sc0002531.1_g000047 Rmu_sc0002715.1_g000007 Rmu_sc0002833.1_g000024 Rmu_sc0003859.1_g000046 Rmu_sc0003894.1_g000008 Rmu_sc0004744.1_g000008 Rmu_sc0004924.1_g000016 Rmu_sc0004991.1_g000004 Rmu_sc0005149.1_g000010 Rmu_sc0005149.1_g000011 Rmu_sc0005489.1_g000007 Rmu_sc0005592.1_g000030 Rmu_sc0005813.1_g000010 Rmu_sc0005813.1_g000011 Rmu_sc0005861.1_g000009 Rmu_sc0005949.1_g000016 Rmu_sc0006824.1_g000021 Rmu_sc0007069.1_g000025 Rmu_sc0008002.1_g000008 Rmu_sc0008148.1_g000008 Rmu_sc0008280.1_g000001 Rmu_sc0008317.1_g000010 Rmu_sc0011615.1_g000002 Rmu_sc0013925.1_g000004 Rmu_sc0014130.1_g000003 Rmu_sc0014510.1_g000008 Rmu_sc0016640.1_g000001 Rmu_sc0018068.1_g000002 Rmu_sc0021371.1_g000006 Rmu_sc0028652.1_g000007 Rmu_sc0032187.1_g000002 Rmu_sc0034241.1_g000001 Rmu_ssc0000127.1_g000003
rosa_roxburghii Rroxscaffold_6G00403950
rosa_rugosa Rorug01G0081700 Rorug02G0544000 Rorug05G0089900 Rorug05G0284500 Rorug05G0452400 Rorug07G0003400 Rorug07G0003400 Rorug07G0129200 Rorug07G0210600
rosa_samantha Rh1AG193900 Rh1AG194000 Rh1DG063400 Rh1DG204700 Rh2AG364300 Rh3BG140200 Rh3CG366000 Rh4DG342600 Rh5AG347700 Rh5BG437300 Rh5CG459900 Rh5DG127400 Rh5DG412800 Rh6BG381500 Rh7CG520500 Rh7DG241900 Rh7DG336000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 122, 437
AclWI GGATC 1 cut(s) 273
AcsI RAATTY 3 cut(s) 388, 548, 569
AfaI GTAC 3 cut(s) 118, 141, 220
AfiI CCNNNNNNNGG 1 cut(s) 427
AgsI TTSAA 1 cut(s) 468
AjnI CCWGG 2 cut(s) 41, 425
AjuI GAANNNNNNNTTGG 1 cut(s) 599
AluBI AGCT 4 cut(s) 173, 365, 408, 505
AluI AGCT 4 cut(s) 173, 365, 408, 505
Alw26I GTCTC 2 cut(s) 101, 435
AlwI GGATC 1 cut(s) 273
ApoI RAATTY 3 cut(s) 388, 548, 569
ArsI GACNNNNNNTTYG 2 cut(s) 373, 405
AspS9I GGNCC 3 cut(s) 319, 482, 563
AsuHPI GGTGA 2 cut(s) 608, 616
AsuII TTCGAA 1 cut(s) 17
AvaII GGWCC 3 cut(s) 319, 482, 563
BccI CCATC 1 cut(s) 124
BceAI ACGGC 2 cut(s) 135, 237
BciT130I CCWGG 2 cut(s) 43, 427
BcoDI GTCTC 2 cut(s) 101, 435
BglII AGATCT 1 cut(s) 453
Bme1390I CCNGG 2 cut(s) 43, 427
Bme18I GGWCC 3 cut(s) 319, 482, 563
BmgT120I GGNCC 3 cut(s) 319, 482, 563
BmiI GGNNCC 4 cut(s) 38, 320, 321, 564
BmrFI CCNGG 2 cut(s) 43, 427
BpmI CTGGAG 1 cut(s) 548
Bpu14I TTCGAA 1 cut(s) 17
BsaJI CCNNGG 3 cut(s) 41, 425, 426
BsaXI ACNNNNNCTCC 2 cut(s) 585, 615
Bsc4I CCNNNNNNNGG 1 cut(s) 427
Bse3DI GCAATG 1 cut(s) 454
BseBI CCWGG 2 cut(s) 43, 427
BseDI CCNNGG 3 cut(s) 41, 425, 426
BseGI GGATG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 427
BseMI GCAATG 1 cut(s) 454
BseMII CTCAG 1 cut(s) 515
BslFI GGGAC 2 cut(s) 332, 357
BslI CCNNNNNNNGG 1 cut(s) 427
BsmAI GTCTC 2 cut(s) 101, 435
BsmFI GGGAC 2 cut(s) 332, 357
Bsp119I TTCGAA 1 cut(s) 17
Bsp143I GATC 2 cut(s) 265, 453
BspACI CCGC 2 cut(s) 122, 437
BspCNI CTCAG 1 cut(s) 514
BspLI GGNNCC 4 cut(s) 38, 320, 321, 564
BspPI GGATC 1 cut(s) 273
BspT104I TTCGAA 1 cut(s) 17
BsrDI GCAATG 1 cut(s) 454
BssECI CCNNGG 3 cut(s) 41, 425, 426
BssMI GATC 2 cut(s) 265, 453
Bst2UI CCWGG 2 cut(s) 43, 427
Bst4CI ACNGT 3 cut(s) 23, 49, 304
BstBI TTCGAA 1 cut(s) 17
BstC8I GCNNGC 2 cut(s) 410, 507
BstDEI CTNAG 3 cut(s) 101, 404, 501
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 2 cut(s) 268, 456
BstMAI GTCTC 2 cut(s) 101, 435
BstMBI GATC 2 cut(s) 265, 453
BstMWI GCNNNNNNNGC 1 cut(s) 414
BstNI CCWGG 2 cut(s) 43, 427
BstNSI RCATGY 1 cut(s) 167
BstSCI CCNGG 2 cut(s) 41, 425
BstX2I RGATCY 2 cut(s) 265, 453
BstYI RGATCY 2 cut(s) 265, 453
BtsCI GGATG 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 54
Cac8I GCNNGC 2 cut(s) 410, 507
Cfr13I GGNCC 3 cut(s) 319, 482, 563
Csp6I GTAC 3 cut(s) 117, 140, 219
CviAII CATG 2 cut(s) 164, 314
CviJI RGCY 7 cut(s) 58, 173, 232, 365, 408, 505, 524
CviKI_1 RGCY 7 cut(s) 58, 173, 232, 365, 408, 505, 524
CviQI GTAC 3 cut(s) 117, 140, 219
DdeI CTNAG 3 cut(s) 101, 404, 501
DpnI GATC 2 cut(s) 267, 455
DpnII GATC 2 cut(s) 265, 453
DraI TTTAAA 1 cut(s) 553
EciI GGCGGA 1 cut(s) 137
Eco47I GGWCC 3 cut(s) 319, 482, 563
EcoO109I RGGNCCY 2 cut(s) 319, 482
EcoRII CCWGG 2 cut(s) 41, 425
FaeI CATG 2 cut(s) 167, 317
FaiI YATR 9 cut(s) 13, 92, 165, 291, 315, 351, 492, 587, 589
FaqI GGGAC 2 cut(s) 332, 357
FatI CATG 2 cut(s) 163, 313
FauI CCCGC 1 cut(s) 430
FokI GGATG 1 cut(s) 69
GsuI CTGGAG 1 cut(s) 548
Hin1II CATG 2 cut(s) 167, 317
HinfI GANTC 2 cut(s) 145, 539
HphI GGTGA 2 cut(s) 608, 616
Hpy166II GTNNAC 4 cut(s) 117, 140, 219, 239
Hpy188I TCNGA 3 cut(s) 150, 283, 567
Hpy188III TCNNGA 2 cut(s) 527, 543
Hpy8I GTNNAC 4 cut(s) 117, 140, 219, 239
HpyAV CCTTC 2 cut(s) 196, 253
HpyCH4III ACNGT 3 cut(s) 23, 49, 304
HpyCH4V TGCA 3 cut(s) 412, 447, 517
HpyF10VI GCNNNNNNNGC 1 cut(s) 414
HpyF3I CTNAG 3 cut(s) 101, 404, 501
Hsp92II CATG 2 cut(s) 167, 317
KflI GGGWCCC 1 cut(s) 319
Kzo9I GATC 2 cut(s) 265, 453
LpnPI CCDG 9 cut(s) 28, 55, 210, 412, 439, 491, 495, 512, 528
MaeIII GTNAC 2 cut(s) 49, 298
MalI GATC 2 cut(s) 267, 455
MboI GATC 2 cut(s) 265, 453
MboII GAAGA 2 cut(s) 139, 619
MflI RGATCY 2 cut(s) 265, 453
MluCI AATT 6 cut(s) 93, 178, 388, 473, 548, 569
MlyI GAGTC 1 cut(s) 548
MmeI TCCRAC 1 cut(s) 311
MnlI CCTC 6 cut(s) 153, 221, 473, 495, 514, 587
MseI TTAA 5 cut(s) 60, 177, 192, 395, 552
MslI CAYNNNNRTG 1 cut(s) 294
MspA1I CMGCKG 1 cut(s) 505
MspR9I CCNGG 2 cut(s) 43, 427
MvaI CCWGG 2 cut(s) 43, 427
MwoI GCNNNNNNNGC 1 cut(s) 414
NdeII GATC 2 cut(s) 265, 453
NlaIII CATG 2 cut(s) 167, 317
NlaIV GGNNCC 4 cut(s) 38, 320, 321, 564
NmuCI GTSAC 1 cut(s) 49
NspI RCATGY 1 cut(s) 167
NspV TTCGAA 1 cut(s) 17
PasI CCCWGGG 1 cut(s) 426
PfeI GAWTC 1 cut(s) 145
PleI GAGTC 1 cut(s) 547
PpsI GAGTC 1 cut(s) 547
PpuMI RGGWCCY 2 cut(s) 319, 482
Psp5II RGGWCCY 2 cut(s) 319, 482
Psp6I CCWGG 2 cut(s) 41, 425
PspGI CCWGG 2 cut(s) 41, 425
PspN4I GGNNCC 4 cut(s) 38, 320, 321, 564
PspPI GGNCC 3 cut(s) 319, 482, 563
PspPPI RGGWCCY 2 cut(s) 319, 482
PsuI RGATCY 2 cut(s) 265, 453
PvuII CAGCTG 1 cut(s) 505
RsaI GTAC 3 cut(s) 118, 141, 220
RsaNI GTAC 3 cut(s) 117, 140, 219
RseI CAYNNNNRTG 1 cut(s) 294
SaqAI TTAA 5 cut(s) 60, 177, 192, 395, 552
Sau3AI GATC 2 cut(s) 265, 453
Sau96I GGNCC 3 cut(s) 319, 482, 563
SchI GAGTC 1 cut(s) 548
ScrFI CCNGG 2 cut(s) 43, 427
SetI ASST 9 cut(s) 175, 188, 264, 367, 410, 423, 484, 507, 598
SfuI TTCGAA 1 cut(s) 17
SinI GGWCC 3 cut(s) 319, 482, 563
SmiMI CAYNNNNRTG 1 cut(s) 294
Sse9I AATT 6 cut(s) 93, 178, 388, 473, 548, 569
SsiI CCGC 2 cut(s) 122, 437
StyD4I CCNGG 2 cut(s) 41, 425
TaaI ACNGT 3 cut(s) 23, 49, 304
TaqI TCGA 1 cut(s) 17
TasI AATT 6 cut(s) 93, 178, 388, 473, 548, 569
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 5 cut(s) 60, 177, 192, 395, 552
Tru9I TTAA 5 cut(s) 60, 177, 192, 395, 552
TscAI CASTG 1 cut(s) 54
TseFI GTSAC 1 cut(s) 49
Tsp45I GTSAC 1 cut(s) 49
TspDTI ATGAA 2 cut(s) 17, 267
TspGWI ACGGA 2 cut(s) 157, 394
TspRI CASTG 1 cut(s) 54
VpaK11BI GGWCC 3 cut(s) 319, 482, 563
XapI RAATTY 3 cut(s) 388, 548, 569
XceI RCATGY 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.