Rmu_sc0008148.1_g000008

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008148.1
OG0000619
Physical Location & Seq
Reverse (-)
14479 .. 15204
726 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008148.1_g000008.1.cds

Sequence Viewer

Length: 726 bp
atgaatatcttgtgttggaactaccaggggattgggaacccctggacagttactgggcttaaagggatagtgtccctcaactttcccagtttgatttttcttagtgaaacacggtgtacagtggaagaaatgaagggggtacgtcggcagttgggtttgaaaaactcatttgctgtggattgcaagtttgttaataggaggaatacgaagggggtgagcagagctggtggactttgtttgttatggaatgacgatgttagcatggctctccaaacttattcagagagtcacattgaagttgtcattggggaaccggggagtcccaattgttggaggtttaagggtttatatggtcaccctaagactgaggagagatatcggacgtggaacttgttgcgtcaattgagcctacaggggaatttgccttgggtggtagggggtgattataatgagattacgattttatccgacaagttgggtggagcgttacgtagtacaagtcagatgagaggcatgtctgaggcgttggagttttgtgaactcgggggcattaaattttttggcccgaggtttacttggagaggtattagaggtggtgaggaggttaaaattagattggatagatttactagctcttcacagtggaaggatttgtttcctgcgtcaagggttaaacaccttgatccatgcaaatctgaccatgttcctattttcttggaagtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

241

Amino Acids

27.31

Weight (kDa)

9.11

Isoelectric Point (pI)

45.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000619)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29861 FvH4_3g26084 FvH4_3g32551 FvH4_4g08193 FvH4_4g12950 FvH4_6g29733
rosa_chinensis RchiOBHm_Chr3g0488921
rosa_multiflora Rmu_co8238041.1_g000001 Rmu_co8265215.1_g000001 Rmu_co8486357.1_g000002 Rmu_sc0000389.1_g000016 Rmu_sc0000580.1_g000123 Rmu_sc0000789.1_g000005 Rmu_sc0001043.1_g000006 Rmu_sc0001208.1_g000001 Rmu_sc0001323.1_g000011 Rmu_sc0001636.1_g000001 Rmu_sc0001911.1_g000023 Rmu_sc0001940.1_g000010 Rmu_sc0002531.1_g000047 Rmu_sc0002715.1_g000007 Rmu_sc0002833.1_g000024 Rmu_sc0003859.1_g000046 Rmu_sc0003894.1_g000008 Rmu_sc0004744.1_g000008 Rmu_sc0004924.1_g000016 Rmu_sc0004991.1_g000004 Rmu_sc0005149.1_g000010 Rmu_sc0005149.1_g000011 Rmu_sc0005489.1_g000007 Rmu_sc0005592.1_g000030 Rmu_sc0005813.1_g000010 Rmu_sc0005813.1_g000011 Rmu_sc0005861.1_g000009 Rmu_sc0005949.1_g000016 Rmu_sc0006824.1_g000021 Rmu_sc0007069.1_g000025 Rmu_sc0008002.1_g000008 Rmu_sc0008148.1_g000008 Rmu_sc0008280.1_g000001 Rmu_sc0008317.1_g000010 Rmu_sc0011615.1_g000002 Rmu_sc0013925.1_g000004 Rmu_sc0014130.1_g000003 Rmu_sc0014510.1_g000008 Rmu_sc0016640.1_g000001 Rmu_sc0018068.1_g000002 Rmu_sc0021371.1_g000006 Rmu_sc0028652.1_g000007 Rmu_sc0032187.1_g000002 Rmu_sc0034241.1_g000001 Rmu_ssc0000127.1_g000003
rosa_roxburghii Rroxscaffold_6G00403950
rosa_rugosa Rorug01G0081700 Rorug02G0544000 Rorug05G0089900 Rorug05G0284500 Rorug05G0452400 Rorug07G0003400 Rorug07G0003400 Rorug07G0129200 Rorug07G0210600
rosa_samantha Rh1AG193900 Rh1AG194000 Rh1DG063400 Rh1DG204700 Rh2AG364300 Rh3BG140200 Rh3CG366000 Rh4DG342600 Rh5AG347700 Rh5BG437300 Rh5CG459900 Rh5DG127400 Rh5DG412800 Rh6BG381500 Rh7CG520500 Rh7DG241900 Rh7DG336000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 447
AccB7I CCANNNNNTGG 1 cut(s) 330
AclWI GGATC 1 cut(s) 677
AcsI RAATTY 2 cut(s) 418, 554
AfaI GTAC 3 cut(s) 118, 141, 496
AfiI CCNNNNNNNGG 1 cut(s) 330
AgsI TTSAA 2 cut(s) 160, 296
AjiI CACGTC 1 cut(s) 384
AjnI CCWGG 2 cut(s) 24, 41
AjuI GAANNNNNNNTTGG 2 cut(s) 288, 320
AluBI AGCT 2 cut(s) 224, 633
AluI AGCT 2 cut(s) 224, 633
AlwI GGATC 1 cut(s) 677
AlwNI CAGNNNCTG 1 cut(s) 53
Ama87I CYCGRG 2 cut(s) 542, 565
AoxI GGCC 1 cut(s) 562
ApoI RAATTY 2 cut(s) 418, 554
AspS9I GGNCC 1 cut(s) 563
AsuC2I CCSGG 1 cut(s) 315
AsuHPI GGTGA 4 cut(s) 226, 347, 452, 608
AvaI CYCGRG 2 cut(s) 542, 565
BciT130I CCWGG 2 cut(s) 26, 43
BcnI CCSGG 1 cut(s) 315
BfaI CTAG 1 cut(s) 630
BfmI CTRYAG 1 cut(s) 410
Bme1390I CCNGG 3 cut(s) 26, 43, 315
BmeT110I CYCGRG 2 cut(s) 542, 565
BmgBI CACGTC 1 cut(s) 384
BmgT120I GGNCC 1 cut(s) 563
BmiI GGNNCC 2 cut(s) 38, 312
BmrFI CCNGG 3 cut(s) 26, 43, 315
BmrI ACTGGG 2 cut(s) 63, 81
BmuI ACTGGG 2 cut(s) 63, 81
BpuMI CCSGG 1 cut(s) 315
BsaAI YACGTR 1 cut(s) 491
BsaJI CCNNGG 5 cut(s) 25, 41, 314, 425, 566
Bsc4I CCNNNNNNNGG 1 cut(s) 330
Bse1I ACTGG 2 cut(s) 58, 87
BseBI CCWGG 2 cut(s) 26, 43
BseDI CCNNGG 5 cut(s) 25, 41, 314, 425, 566
BseLI CCNNNNNNNGG 1 cut(s) 330
BseMII CTCAG 2 cut(s) 357, 510
BseNI ACTGG 2 cut(s) 58, 87
BseRI GAGGAG 2 cut(s) 383, 614
BshFI GGCC 1 cut(s) 564
BsiHKCI CYCGRG 2 cut(s) 542, 565
BsiSI CCGG 1 cut(s) 314
BslFI GGGAC 2 cut(s) 58, 306
BslI CCNNNNNNNGG 1 cut(s) 330
BsmFI GGGAC 2 cut(s) 58, 306
BsnI GGCC 1 cut(s) 564
BsoBI CYCGRG 2 cut(s) 542, 565
Bsp1407I TGTACA 1 cut(s) 116
Bsp143I GATC 1 cut(s) 682
BspANI GGCC 1 cut(s) 564
BspCNI CTCAG 2 cut(s) 358, 511
BspLI GGNNCC 2 cut(s) 38, 312
BspPI GGATC 1 cut(s) 677
BspQI GCTCTTC 1 cut(s) 640
BsrGI TGTACA 1 cut(s) 116
BsrI ACTGG 2 cut(s) 58, 87
BssECI CCNNGG 5 cut(s) 25, 41, 314, 425, 566
BssMI GATC 1 cut(s) 682
BssT1I CCWWGG 1 cut(s) 425
Bst2UI CCWGG 2 cut(s) 26, 43
Bst4CI ACNGT 4 cut(s) 49, 114, 121, 642
Bst6I CTCTTC 1 cut(s) 640
BstAUI TGTACA 1 cut(s) 116
BstBAI YACGTR 1 cut(s) 491
BstDEI CTNAG 4 cut(s) 101, 360, 366, 519
BstEII GGTNACC 1 cut(s) 353
BstKTI GATC 1 cut(s) 685
BstMBI GATC 1 cut(s) 682
BstNI CCWGG 2 cut(s) 26, 43
BstNSI RCATGY 1 cut(s) 517
BstPI GGTNACC 1 cut(s) 353
BstSCI CCNGG 3 cut(s) 24, 41, 313
BstSFI CTRYAG 1 cut(s) 410
BstSNI TACGTA 1 cut(s) 491
BstXI CCANNNNNNTGG 1 cut(s) 32
BsuRI GGCC 1 cut(s) 564
BtrI CACGTC 1 cut(s) 384
BtsIMutI CAGTG 2 cut(s) 126, 647
CaiI CAGNNNCTG 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 563
CseI GACGC 2 cut(s) 386, 651
Csp6I GTAC 3 cut(s) 117, 140, 495
CspCI CAANNNNNGTGG 2 cut(s) 460, 495
CviAII CATG 4 cut(s) 262, 514, 687, 701
CviJI RGCY 6 cut(s) 58, 224, 266, 408, 564, 633
CviKI_1 RGCY 6 cut(s) 58, 224, 266, 408, 564, 633
CviQI GTAC 3 cut(s) 117, 140, 495
DdeI CTNAG 4 cut(s) 101, 360, 366, 519
DpnI GATC 1 cut(s) 684
DpnII GATC 1 cut(s) 682
Eam1104I CTCTTC 1 cut(s) 640
EarI CTCTTC 1 cut(s) 640
Eco105I TACGTA 1 cut(s) 491
Eco130I CCWWGG 1 cut(s) 425
Eco32I GATATC 1 cut(s) 377
Eco88I CYCGRG 2 cut(s) 542, 565
Eco91I GGTNACC 1 cut(s) 353
EcoO65I GGTNACC 1 cut(s) 353
EcoRII CCWGG 2 cut(s) 24, 41
EcoRV GATATC 1 cut(s) 377
EcoT14I CCWWGG 1 cut(s) 425
ErhI CCWWGG 1 cut(s) 425
FaeI CATG 4 cut(s) 265, 517, 690, 704
FaiI YATR 8 cut(s) 244, 263, 349, 351, 447, 515, 688, 702
FaqI GGGAC 2 cut(s) 58, 306
FatI CATG 4 cut(s) 261, 513, 686, 700
FspBI CTAG 1 cut(s) 630
HaeIII GGCC 1 cut(s) 564
HapII CCGG 1 cut(s) 314
HgaI GACGC 2 cut(s) 386, 651
Hin1II CATG 4 cut(s) 265, 517, 690, 704
HinfI GANTC 2 cut(s) 286, 319
HpaII CCGG 1 cut(s) 314
HphI GGTGA 4 cut(s) 226, 347, 452, 608
Hpy166II GTNNAC 4 cut(s) 117, 230, 539, 573
Hpy188I TCNGA 7 cut(s) 283, 381, 469, 504, 520, 697, 725
Hpy8I GTNNAC 4 cut(s) 117, 230, 539, 573
Hpy99I CGWCG 1 cut(s) 147
HpyAV CCTTC 3 cut(s) 127, 202, 640
HpyCH4III ACNGT 4 cut(s) 49, 114, 121, 642
HpyCH4IV ACGT 3 cut(s) 142, 383, 490
HpyCH4V TGCA 2 cut(s) 183, 690
HpyF3I CTNAG 4 cut(s) 101, 360, 366, 519
HpySE526I ACGT 3 cut(s) 142, 383, 490
Hsp92II CATG 4 cut(s) 265, 517, 690, 704
Kzo9I GATC 1 cut(s) 682
LguI GCTCTTC 1 cut(s) 640
LmnI GCTCC 1 cut(s) 482
MaeI CTAG 1 cut(s) 630
MaeII ACGT 3 cut(s) 142, 383, 490
MaeIII GTNAC 4 cut(s) 49, 287, 353, 486
MalI GATC 1 cut(s) 684
MboI GATC 1 cut(s) 682
MboII GAAGA 2 cut(s) 137, 627
MfeI CAATTG 2 cut(s) 325, 401
MluCI AATT 5 cut(s) 325, 401, 418, 554, 609
MlyI GAGTC 2 cut(s) 295, 328
MmeI TCCRAC 3 cut(s) 311, 492, 507
MseI TTAA 6 cut(s) 60, 192, 339, 552, 606, 672
MspI CCGG 1 cut(s) 314
MspR9I CCNGG 3 cut(s) 26, 43, 315
MunI CAATTG 2 cut(s) 325, 401
MvaI CCWGG 2 cut(s) 26, 43
NciI CCSGG 1 cut(s) 315
NdeII GATC 1 cut(s) 682
NlaIII CATG 4 cut(s) 265, 517, 690, 704
NlaIV GGNNCC 2 cut(s) 38, 312
NmuCI GTSAC 2 cut(s) 287, 353
NspI RCATGY 1 cut(s) 517
PciSI GCTCTTC 1 cut(s) 640
PflMI CCANNNNNTGG 1 cut(s) 330
PleI GAGTC 2 cut(s) 294, 327
PpsI GAGTC 2 cut(s) 294, 327
Ppu21I YACGTR 1 cut(s) 491
PsiI TTATAA 1 cut(s) 447
Psp6I CCWGG 2 cut(s) 24, 41
PspEI GGTNACC 1 cut(s) 353
PspGI CCWGG 2 cut(s) 24, 41
PspN4I GGNNCC 2 cut(s) 38, 312
PspPI GGNCC 1 cut(s) 563
PstNI CAGNNNCTG 1 cut(s) 53
RsaI GTAC 3 cut(s) 118, 141, 496
RsaNI GTAC 3 cut(s) 117, 140, 495
SapI GCTCTTC 1 cut(s) 640
SaqAI TTAA 6 cut(s) 60, 192, 339, 552, 606, 672
Sau3AI GATC 1 cut(s) 682
Sau96I GGNCC 1 cut(s) 563
SchI GAGTC 2 cut(s) 295, 328
ScrFI CCNGG 3 cut(s) 26, 43, 315
SfcI CTRYAG 1 cut(s) 410
SnaBI TACGTA 1 cut(s) 491
Sse9I AATT 5 cut(s) 325, 401, 418, 554, 609
SspMI CTAG 1 cut(s) 630
StyD4I CCNGG 3 cut(s) 24, 41, 313
StyI CCWWGG 1 cut(s) 425
TaaI ACNGT 4 cut(s) 49, 114, 121, 642
TaiI ACGT 3 cut(s) 145, 386, 493
TasI AATT 5 cut(s) 325, 401, 418, 554, 609
TatI WGTACW 2 cut(s) 116, 494
Tru1I TTAA 6 cut(s) 60, 192, 339, 552, 606, 672
Tru9I TTAA 6 cut(s) 60, 192, 339, 552, 606, 672
TscAI CASTG 2 cut(s) 126, 647
TseFI GTSAC 2 cut(s) 287, 353
Tsp45I GTSAC 2 cut(s) 287, 353
TspDTI ATGAA 2 cut(s) 17, 146
TspRI CASTG 2 cut(s) 126, 647
Van91I CCANNNNNTGG 1 cut(s) 330
XapI RAATTY 2 cut(s) 418, 554
XceI RCATGY 1 cut(s) 517
XspI CTAG 1 cut(s) 630
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.