FvH4_4g15892

TdcA1-ORF2 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000224
Physical Location & Seq
Reverse (-)
19841399 .. 19842112
714 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g15892.t1

Sequence Viewer

Length: 489 bp
ATGACTAAACGTACTCGTCTGCAAACTGCCAATCAGTCATGCCAAAATTCTGCAGAAGATGGACTGAATTCTACTACTGCTGTCGCCATAGAACGAACTACTACTGGGACTAGAGTTAGTACACGTCTTCATCATCAAATTGTTAATGATCAGCCGGTGAGAAACGCTATAACTGAAGAACGAAATGATATTGTGATGTCAGATATTAATCAAGAGCCTCCTTCAGGTCCAACAAAAAAGGTGCGGGGGAAGACAAGAGGAGTGAATGCAGATAAGGTGTTCTCCCAGTTGAATTCTAAACTTCCTGTCACTCTGACCGAACAAAATGGCAGACCTACAGGGCCTTATGCTGAGATGTTTGCAAATGAAATTGGTTACACAATTCGAAACCATGCCCCTCTTAATGTGGAGAAATGGAAGAAGATTAACAAAGTGGACGTGGACAACATGATCAAAAGAATGCAGGTGAGTGATGACTTGTTTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21 Transposase_24

Protein Analysis

163

Amino Acids

18.22

Weight (kDa)

9.51

Isoelectric Point (pI)

37.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 454
Acc36I ACCTGC 1 cut(s) 454
AciI CCGC 1 cut(s) 244
AcsI RAATTY 3 cut(s) 46, 67, 292
AcuI CTGAAG 2 cut(s) 195, 207
AfaI GTAC 2 cut(s) 13, 121
AfiI CCNNNNNNNGG 1 cut(s) 224
AflIII ACRYGT 1 cut(s) 122
AgsI TTSAA 1 cut(s) 292
AjiI CACGTC 2 cut(s) 125, 439
AoxI GGCC 1 cut(s) 341
ApoI RAATTY 3 cut(s) 46, 67, 292
AseI ATTAAT 1 cut(s) 207
AspS9I GGNCC 2 cut(s) 227, 341
AsuHPI GGTGA 2 cut(s) 169, 478
AsuII TTCGAA 1 cut(s) 385
AvaII GGWCC 1 cut(s) 227
BbsI GAAGAC 2 cut(s) 119, 257
BccI CCATC 1 cut(s) 53
BclI TGATCA 2 cut(s) 148, 450
BfaI CTAG 1 cut(s) 111
BfmI CTRYAG 2 cut(s) 51, 336
BfuAI ACCTGC 1 cut(s) 454
Bme18I GGWCC 1 cut(s) 227
BmgBI CACGTC 2 cut(s) 125, 439
BmgT120I GGNCC 2 cut(s) 227, 341
BmrI ACTGGG 2 cut(s) 114, 280
BmuI ACTGGG 2 cut(s) 114, 280
BpiI GAAGAC 2 cut(s) 119, 257
Bpu14I TTCGAA 1 cut(s) 385
BsaBI GATNNNNATC 1 cut(s) 207
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse118I RCCGGY 1 cut(s) 154
Bse1I ACTGG 2 cut(s) 109, 286
Bse8I GATNNNNATC 1 cut(s) 207
BseJI GATNNNNATC 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 342
BseNI ACTGG 2 cut(s) 109, 286
BseRI GAGGAG 1 cut(s) 273
BshFI GGCC 1 cut(s) 343
BsiSI CCGG 1 cut(s) 155
BslFI GGGAC 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 224
BsmFI GGGAC 1 cut(s) 121
BsmI GAATGC 2 cut(s) 271, 465
BsnI GGCC 1 cut(s) 343
Bsp119I TTCGAA 1 cut(s) 385
Bsp143I GATC 2 cut(s) 148, 450
BspACI CCGC 1 cut(s) 244
BspANI GGCC 1 cut(s) 343
BspCNI CTCAG 1 cut(s) 343
BspMAI CTGCAG 1 cut(s) 55
BspMI ACCTGC 1 cut(s) 454
BspT104I TTCGAA 1 cut(s) 385
BsrFI RCCGGY 1 cut(s) 154
BsrI ACTGG 2 cut(s) 109, 286
BssAI RCCGGY 1 cut(s) 154
BssMI GATC 2 cut(s) 148, 450
BstBI TTCGAA 1 cut(s) 385
BstDEI CTNAG 1 cut(s) 351
BstENI CCTNNNNNAGG 1 cut(s) 222
BstKTI GATC 2 cut(s) 151, 453
BstMBI GATC 2 cut(s) 148, 450
BstSFI CTRYAG 2 cut(s) 51, 336
BstV2I GAAGAC 2 cut(s) 119, 257
BsuRI GGCC 1 cut(s) 343
BtrI CACGTC 2 cut(s) 125, 439
BveI ACCTGC 1 cut(s) 454
Cfr10I RCCGGY 1 cut(s) 154
Cfr13I GGNCC 2 cut(s) 227, 341
Csp6I GTAC 2 cut(s) 12, 120
CviAII CATG 3 cut(s) 39, 392, 448
CviJI RGCY 3 cut(s) 154, 217, 343
CviKI_1 RGCY 3 cut(s) 154, 217, 343
CviQI GTAC 2 cut(s) 12, 120
DdeI CTNAG 1 cut(s) 351
DpnI GATC 2 cut(s) 150, 452
DpnII GATC 2 cut(s) 148, 450
Eco47I GGWCC 1 cut(s) 227
Eco57I CTGAAG 2 cut(s) 195, 207
EcoNI CCTNNNNNAGG 1 cut(s) 222
EcoO109I RGGNCCY 1 cut(s) 341
EcoRI GAATTC 2 cut(s) 67, 292
FaeI CATG 3 cut(s) 42, 395, 451
FaiI YATR 6 cut(s) 40, 89, 170, 348, 393, 449
FaqI GGGAC 1 cut(s) 121
FatI CATG 3 cut(s) 38, 391, 447
FauI CCCGC 1 cut(s) 237
FbaI TGATCA 2 cut(s) 148, 450
FspBI CTAG 1 cut(s) 111
HaeIII GGCC 1 cut(s) 343
HapII CCGG 1 cut(s) 155
Hin1II CATG 3 cut(s) 42, 395, 451
HpaII CCGG 1 cut(s) 155
HphI GGTGA 2 cut(s) 169, 478
Hpy166II GTNNAC 3 cut(s) 122, 436, 442
Hpy188I TCNGA 3 cut(s) 202, 315, 488
Hpy188III TCNNGA 1 cut(s) 212
Hpy8I GTNNAC 3 cut(s) 122, 436, 442
HpyAV CCTTC 1 cut(s) 231
HpyCH4IV ACGT 3 cut(s) 10, 124, 438
HpyCH4V TGCA 5 cut(s) 22, 53, 269, 362, 463
HpyF3I CTNAG 1 cut(s) 351
HpySE526I ACGT 3 cut(s) 10, 124, 438
Hsp92II CATG 3 cut(s) 42, 395, 451
Ksp22I TGATCA 2 cut(s) 148, 450
Kzo9I GATC 2 cut(s) 148, 450
LpnPI CCDG 7 cut(s) 90, 168, 210, 299, 318, 324, 449
MaeI CTAG 1 cut(s) 111
MaeII ACGT 3 cut(s) 10, 124, 438
MaeIII GTNAC 2 cut(s) 307, 374
MalI GATC 2 cut(s) 150, 452
MboI GATC 2 cut(s) 148, 450
MboII GAAGA 6 cut(s) 68, 119, 188, 262, 430, 433
MluCI AATT 6 cut(s) 46, 67, 138, 292, 369, 381
MmeI TCCRAC 1 cut(s) 254
MnlI CCTC 3 cut(s) 228, 251, 408
MseI TTAA 4 cut(s) 144, 207, 402, 426
MspI CCGG 1 cut(s) 155
Mva1269I GAATGC 2 cut(s) 271, 465
NdeII GATC 2 cut(s) 148, 450
NlaIII CATG 3 cut(s) 42, 395, 451
NmuCI GTSAC 1 cut(s) 307
NspV TTCGAA 1 cut(s) 385
PaqCI CACCTGC 1 cut(s) 454
PctI GAATGC 2 cut(s) 271, 465
PshBI ATTAAT 1 cut(s) 207
PspPI GGNCC 2 cut(s) 227, 341
PstI CTGCAG 1 cut(s) 55
RsaI GTAC 2 cut(s) 13, 121
RsaNI GTAC 2 cut(s) 12, 120
SaqAI TTAA 4 cut(s) 144, 207, 402, 426
Sau3AI GATC 2 cut(s) 148, 450
Sau96I GGNCC 2 cut(s) 227, 341
SetI ASST 8 cut(s) 13, 127, 229, 243, 279, 337, 441, 468
SfcI CTRYAG 2 cut(s) 51, 336
SfuI TTCGAA 1 cut(s) 385
SinI GGWCC 1 cut(s) 227
Sse9I AATT 6 cut(s) 46, 67, 138, 292, 369, 381
SsiI CCGC 1 cut(s) 244
SspMI CTAG 1 cut(s) 111
TaiI ACGT 3 cut(s) 13, 127, 441
TaqI TCGA 1 cut(s) 385
TaqII GACCGA 1 cut(s) 332
TasI AATT 6 cut(s) 46, 67, 138, 292, 369, 381
TatI WGTACW 1 cut(s) 119
Tru1I TTAA 4 cut(s) 144, 207, 402, 426
Tru9I TTAA 4 cut(s) 144, 207, 402, 426
TseFI GTSAC 1 cut(s) 307
Tsp45I GTSAC 1 cut(s) 307
TspDTI ATGAA 2 cut(s) 119, 381
VpaK11BI GGWCC 1 cut(s) 227
VspI ATTAAT 1 cut(s) 207
XagI CCTNNNNNAGG 1 cut(s) 222
XapI RAATTY 3 cut(s) 46, 67, 292
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.