Rmu_sc0004546.1_g000001

Conserved gene of

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004546.1
OG0000224
Physical Location & Seq
Forward (+)
2197 .. 2538
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004546.1_g000001.1.cds

Sequence Viewer

Length: 342 bp
atgattaagatgcgaactgagacaactcaacctgatggaactcggacaatgacagatgatgaaatttgtgcaaaagtccatggagtcaaatcaggctacatcaagggtagttgtggttttggccctagacctccaccttcaagggtctctcatttgttgataaatgaaatgtctgaaaagaacaatgagttacaagaacagcttcaagagacccatcaccttgtagggactcaacaacaaaagattgatgcacaaaatgaggtgatccaaagattggaggagcaagccaaaaagtttgaggagttcatggttaacttttccagacaacacccatcaagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transposase_24

Protein Analysis

113

Amino Acids

12.92

Weight (kDa)

6.19

Isoelectric Point (pI)

50.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 274
AclWI GGATC 1 cut(s) 259
AcsI RAATTY 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 274
AgsI TTSAA 2 cut(s) 141, 206
AluBI AGCT 1 cut(s) 202
AluI AGCT 1 cut(s) 202
Alw26I GTCTC 3 cut(s) 14, 151, 203
AlwI GGATC 1 cut(s) 259
AoxI GGCC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 63
Asp700I GAANNNNTTC 1 cut(s) 201
AspS9I GGNCC 1 cut(s) 122
AsuHPI GGTGA 2 cut(s) 209, 274
BccI CCATC 3 cut(s) 29, 222, 340
BcoDI GTCTC 3 cut(s) 14, 151, 203
BfaI CTAG 1 cut(s) 126
BmgT120I GGNCC 1 cut(s) 122
BmsI GCATC 1 cut(s) 238
BsaI GGTCTC 2 cut(s) 151, 203
BsaJI CCNNGG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 274
BseDI CCNNGG 1 cut(s) 79
BseLI CCNNNNNNNGG 1 cut(s) 274
BseMII CTCAG 1 cut(s) 9
BseRI GAGGAG 2 cut(s) 293, 314
BshFI GGCC 1 cut(s) 123
BslFI GGGAC 1 cut(s) 241
BslI CCNNNNNNNGG 1 cut(s) 274
BsmAI GTCTC 3 cut(s) 14, 151, 203
BsmFI GGGAC 1 cut(s) 241
BsnI GGCC 1 cut(s) 123
Bso31I GGTCTC 2 cut(s) 151, 203
Bsp143I GATC 1 cut(s) 264
Bsp19I CCATGG 1 cut(s) 79
BspANI GGCC 1 cut(s) 123
BspCNI CTCAG 1 cut(s) 10
BspPI GGATC 1 cut(s) 259
BspTNI GGTCTC 2 cut(s) 151, 203
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 264
BssT1I CCWWGG 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 285
BstDEI CTNAG 1 cut(s) 18
BstDSI CCRYGG 1 cut(s) 79
BstKTI GATC 1 cut(s) 267
BstMAI GTCTC 3 cut(s) 14, 151, 203
BstMBI GATC 1 cut(s) 264
BsuRI GGCC 1 cut(s) 123
BtgI CCRYGG 1 cut(s) 79
Cac8I GCNNGC 1 cut(s) 285
Cfr13I GGNCC 1 cut(s) 122
CviAII CATG 2 cut(s) 80, 307
CviJI RGCY 4 cut(s) 96, 123, 202, 287
CviKI_1 RGCY 4 cut(s) 96, 123, 202, 287
DdeI CTNAG 1 cut(s) 18
DpnI GATC 1 cut(s) 266
DpnII GATC 1 cut(s) 264
Eco130I CCWWGG 1 cut(s) 79
Eco31I GGTCTC 2 cut(s) 151, 203
EcoT14I CCWWGG 1 cut(s) 79
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 2 cut(s) 83, 310
FaiI YATR 2 cut(s) 81, 308
FalI AAGNNNNNCTT 2 cut(s) 186, 218
FaqI GGGAC 1 cut(s) 241
FatI CATG 2 cut(s) 79, 306
FspBI CTAG 1 cut(s) 126
HaeIII GGCC 1 cut(s) 123
Hin1II CATG 2 cut(s) 83, 310
HincII GTYRAC 1 cut(s) 313
HindII GTYRAC 1 cut(s) 313
HinfI GANTC 2 cut(s) 84, 229
HpaI GTTAAC 1 cut(s) 313
HphI GGTGA 2 cut(s) 209, 274
Hpy166II GTNNAC 1 cut(s) 313
Hpy188I TCNGA 2 cut(s) 45, 175
Hpy188III TCNNGA 2 cut(s) 206, 321
Hpy8I GTNNAC 1 cut(s) 313
HpyAV CCTTC 1 cut(s) 147
HpyCH4V TGCA 2 cut(s) 71, 251
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 2 cut(s) 83, 310
KspAI GTTAAC 1 cut(s) 313
Kzo9I GATC 1 cut(s) 264
LmnI GCTCC 1 cut(s) 280
LpnPI CCDG 3 cut(s) 45, 78, 334
LweI GCATC 1 cut(s) 238
MaeI CTAG 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 189
MalI GATC 1 cut(s) 266
MboI GATC 1 cut(s) 264
MluCI AATT 1 cut(s) 63
MlyI GAGTC 2 cut(s) 93, 223
MnlI CCTC 4 cut(s) 141, 253, 271, 292
MroXI GAANNNNTTC 1 cut(s) 201
MseI TTAA 2 cut(s) 6, 312
NcoI CCATGG 1 cut(s) 79
NdeII GATC 1 cut(s) 264
NlaIII CATG 2 cut(s) 83, 310
PdmI GAANNNNTTC 1 cut(s) 201
PflMI CCANNNNNTGG 1 cut(s) 274
PleI GAGTC 2 cut(s) 92, 223
PpsI GAGTC 2 cut(s) 92, 223
PspPI GGNCC 1 cut(s) 122
SaqAI TTAA 2 cut(s) 6, 312
Sau3AI GATC 1 cut(s) 264
Sau96I GGNCC 1 cut(s) 122
SchI GAGTC 2 cut(s) 93, 223
SetI ASST 6 cut(s) 34, 133, 139, 204, 222, 264
SfaNI GCATC 1 cut(s) 238
Sse9I AATT 1 cut(s) 63
SspMI CTAG 1 cut(s) 126
StyI CCWWGG 1 cut(s) 79
TasI AATT 1 cut(s) 63
Tru1I TTAA 2 cut(s) 6, 312
Tru9I TTAA 2 cut(s) 6, 312
TspDTI ATGAA 3 cut(s) 75, 180, 295
Van91I CCANNNNNTGG 1 cut(s) 274
XapI RAATTY 1 cut(s) 63
XmnI GAANNNNTTC 1 cut(s) 201
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.