Rmu_sc0001470.1_g000010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001470.1
OG0000224
Physical Location & Seq
Reverse (-)
49875 .. 50207
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001470.1_g000010.1.cds

Sequence Viewer

Length: 333 bp
atgcgaattgagacaactcaacctgatggaactcggacaatgacagatgatgaaatttgtgcaaaagtccttggagtcaaatcaggaggctacatcaagggttgtggttttggccctggacctccaccattaggagtctctcattcgtcgataaatgaaatgtctaaaaagaacaaagtgttgaaagaacagcttcaagagacccaacaccttgtagggactcaacaacaaaagattgatgcacaaaatgaggtgatccaaagattggaggagcaagccaaaaagtttgaggagttcatagctaacttttccgggccacatccatcaagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.08

Weight (kDa)

6.28

Isoelectric Point (pI)

37.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 265
AclWI GGATC 1 cut(s) 250
AcsI RAATTY 1 cut(s) 54
AfiI CCNNNNNNNGG 2 cut(s) 131, 265
AgsI TTSAA 2 cut(s) 184, 197
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 2 cut(s) 193, 302
AluI AGCT 2 cut(s) 193, 302
Alw26I GTCTC 3 cut(s) 5, 142, 194
AlwI GGATC 1 cut(s) 250
AoxI GGCC 2 cut(s) 112, 314
ApoI RAATTY 1 cut(s) 54
Asp700I GAANNNNTTC 1 cut(s) 192
AspS9I GGNCC 3 cut(s) 113, 119, 314
AsuC2I CCSGG 1 cut(s) 313
AsuHPI GGTGA 1 cut(s) 265
AvaII GGWCC 1 cut(s) 119
BccI CCATC 2 cut(s) 20, 331
BciT130I CCWGG 1 cut(s) 117
BcnI CCSGG 1 cut(s) 313
BcoDI GTCTC 3 cut(s) 5, 142, 194
Bme1390I CCNGG 2 cut(s) 117, 313
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 3 cut(s) 113, 119, 314
BmrFI CCNGG 2 cut(s) 117, 313
BmsI GCATC 1 cut(s) 229
BpuMI CCSGG 1 cut(s) 313
BsaI GGTCTC 1 cut(s) 194
BsaJI CCNNGG 2 cut(s) 70, 115
Bsc4I CCNNNNNNNGG 2 cut(s) 131, 265
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 2 cut(s) 70, 115
BseGI GGATG 1 cut(s) 319
BseLI CCNNNNNNNGG 2 cut(s) 131, 265
BseRI GAGGAG 2 cut(s) 284, 305
BshFI GGCC 2 cut(s) 114, 316
BsiSI CCGG 1 cut(s) 312
BslFI GGGAC 1 cut(s) 232
BslI CCNNNNNNNGG 2 cut(s) 131, 265
BsmAI GTCTC 3 cut(s) 5, 142, 194
BsmFI GGGAC 1 cut(s) 232
BsnI GGCC 2 cut(s) 114, 316
Bso31I GGTCTC 1 cut(s) 194
Bsp143I GATC 1 cut(s) 255
BspANI GGCC 2 cut(s) 114, 316
BspPI GGATC 1 cut(s) 250
BspTNI GGTCTC 1 cut(s) 194
BssECI CCNNGG 2 cut(s) 70, 115
BssMI GATC 1 cut(s) 255
BssT1I CCWWGG 1 cut(s) 70
Bst2UI CCWGG 1 cut(s) 117
BstC8I GCNNGC 1 cut(s) 276
BstF5I GGATG 1 cut(s) 319
BstKTI GATC 1 cut(s) 258
BstMAI GTCTC 3 cut(s) 5, 142, 194
BstMBI GATC 1 cut(s) 255
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 2 cut(s) 115, 311
BsuRI GGCC 2 cut(s) 114, 316
BtsCI GGATG 1 cut(s) 319
Cac8I GCNNGC 1 cut(s) 276
Cfr13I GGNCC 3 cut(s) 113, 119, 314
CspCI CAANNNNNGTGG 2 cut(s) 85, 120
CviJI RGCY 6 cut(s) 90, 114, 193, 278, 302, 316
CviKI_1 RGCY 6 cut(s) 90, 114, 193, 278, 302, 316
DpnI GATC 1 cut(s) 257
DpnII GATC 1 cut(s) 255
Eco130I CCWWGG 1 cut(s) 70
Eco31I GGTCTC 1 cut(s) 194
Eco47I GGWCC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 70
FaiI YATR 1 cut(s) 299
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FaqI GGGAC 1 cut(s) 232
FokI GGATG 1 cut(s) 306
HaeIII GGCC 2 cut(s) 114, 316
HapII CCGG 1 cut(s) 312
HinfI GANTC 3 cut(s) 75, 135, 220
HpaII CCGG 1 cut(s) 312
HphI GGTGA 1 cut(s) 265
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 2 cut(s) 84, 197
Hpy99I CGWCG 1 cut(s) 151
HpyCH4V TGCA 2 cut(s) 62, 242
Kzo9I GATC 1 cut(s) 255
LmnI GCTCC 1 cut(s) 271
LpnPI CCDG 5 cut(s) 36, 69, 102, 129, 325
LweI GCATC 1 cut(s) 229
MalI GATC 1 cut(s) 257
MboI GATC 1 cut(s) 255
MluCI AATT 2 cut(s) 6, 54
MlyI GAGTC 3 cut(s) 84, 144, 214
MnlI CCTC 5 cut(s) 80, 132, 244, 262, 283
MroXI GAANNNNTTC 1 cut(s) 192
MspI CCGG 1 cut(s) 312
MspR9I CCNGG 2 cut(s) 117, 313
MvaI CCWGG 1 cut(s) 117
NciI CCSGG 1 cut(s) 313
NdeII GATC 1 cut(s) 255
PdmI GAANNNNTTC 1 cut(s) 192
PflMI CCANNNNNTGG 1 cut(s) 265
PleI GAGTC 3 cut(s) 83, 143, 214
PpsI GAGTC 3 cut(s) 83, 143, 214
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspPI GGNCC 3 cut(s) 113, 119, 314
Sau3AI GATC 1 cut(s) 255
Sau96I GGNCC 3 cut(s) 113, 119, 314
SchI GAGTC 3 cut(s) 84, 144, 214
ScrFI CCNGG 2 cut(s) 117, 313
SetI ASST 6 cut(s) 25, 124, 195, 213, 255, 304
SfaNI GCATC 1 cut(s) 229
SinI GGWCC 1 cut(s) 119
Sse9I AATT 2 cut(s) 6, 54
StyD4I CCNGG 2 cut(s) 115, 311
StyI CCWWGG 1 cut(s) 70
TaqI TCGA 1 cut(s) 149
TasI AATT 2 cut(s) 6, 54
TspDTI ATGAA 3 cut(s) 66, 171, 286
Van91I CCANNNNNTGG 1 cut(s) 265
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 1 cut(s) 54
XmnI GAANNNNTTC 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.