RchiOBHm_Chr5g0001961

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000224
Physical Location & Seq
Forward (+)
1117699 .. 1121188
3490 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28334

Sequence Viewer

Length: 231 bp
ATGGTTAAGATGCGAATTGAGACAACTCTTCCTGATGGGACTCGAACCATGAATGATGATGAAATATGCGCAAAGGTTCTTGGAATAAAATCAGGCTATATCAAGGGTTCTGGTTTTGGCCTTAGGCCTCCACCATCTAGCACTTCTCGATCATCAATAGATGAAATGTCTAAGAAGAATAAAGAGTTAGAAGATAAACTTGAAGAGACCCAAGATACTATAAAGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.41

Weight (kDa)

6.24

Isoelectric Point (pI)

52.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 70
AgsI TTSAA 1 cut(s) 203
Alw26I GTCTC 2 cut(s) 14, 200
AoxI GGCC 2 cut(s) 118, 125
AspLEI GCGC 1 cut(s) 71
AxyI CCTNAGG 1 cut(s) 122
BccI CCATC 2 cut(s) 29, 142
BcoDI GTCTC 2 cut(s) 14, 200
BfaI CTAG 1 cut(s) 138
BsaI GGTCTC 1 cut(s) 200
Bse21I CCTNAGG 1 cut(s) 122
BshFI GGCC 2 cut(s) 120, 127
BslFI GGGAC 1 cut(s) 52
BsmAI GTCTC 2 cut(s) 14, 200
BsmFI GGGAC 1 cut(s) 52
BsnI GGCC 2 cut(s) 120, 127
Bso31I GGTCTC 1 cut(s) 200
Bsp143I GATC 1 cut(s) 149
BspANI GGCC 2 cut(s) 120, 127
BspTNI GGTCTC 1 cut(s) 200
BssMI GATC 1 cut(s) 149
Bst6I CTCTTC 2 cut(s) 33, 198
BstDEI CTNAG 2 cut(s) 122, 171
BstHHI GCGC 1 cut(s) 71
BstKTI GATC 1 cut(s) 152
BstMAI GTCTC 2 cut(s) 14, 200
BstMBI GATC 1 cut(s) 149
Bsu36I CCTNAGG 1 cut(s) 122
BsuRI GGCC 2 cut(s) 120, 127
CfoI GCGC 1 cut(s) 71
CviAII CATG 1 cut(s) 49
CviJI RGCY 4 cut(s) 96, 120, 127, 227
CviKI_1 RGCY 4 cut(s) 96, 120, 127, 227
DdeI CTNAG 2 cut(s) 122, 171
DpnI GATC 1 cut(s) 151
DpnII GATC 1 cut(s) 149
Eam1104I CTCTTC 2 cut(s) 33, 198
EarI CTCTTC 2 cut(s) 33, 198
Eco147I AGGCCT 1 cut(s) 127
Eco31I GGTCTC 1 cut(s) 200
Eco81I CCTNAGG 1 cut(s) 122
FaeI CATG 1 cut(s) 52
FaiI YATR 4 cut(s) 50, 67, 99, 221
FalI AAGNNNNNCTT 2 cut(s) 183, 215
FaqI GGGAC 1 cut(s) 52
FatI CATG 1 cut(s) 48
FspBI CTAG 1 cut(s) 138
FspI TGCGCA 1 cut(s) 70
GlaI GCGC 1 cut(s) 70
HaeIII GGCC 2 cut(s) 120, 127
HhaI GCGC 1 cut(s) 71
Hin1II CATG 1 cut(s) 52
Hin6I GCGC 1 cut(s) 69
HinP1I GCGC 1 cut(s) 69
HinfI GANTC 1 cut(s) 40
Hpy188III TCNNGA 2 cut(s) 32, 147
HpyF3I CTNAG 2 cut(s) 122, 171
Hsp92II CATG 1 cut(s) 52
HspAI GCGC 1 cut(s) 69
Kzo9I GATC 1 cut(s) 149
LpnPI CCDG 3 cut(s) 45, 78, 96
MaeI CTAG 1 cut(s) 138
MalI GATC 1 cut(s) 151
MboI GATC 1 cut(s) 149
MboII GAAGA 4 cut(s) 20, 187, 203, 215
MluCI AATT 1 cut(s) 15
MlyI GAGTC 1 cut(s) 34
MnlI CCTC 1 cut(s) 138
MseI TTAA 2 cut(s) 6, 229
NdeII GATC 1 cut(s) 149
NlaIII CATG 1 cut(s) 52
NsbI TGCGCA 1 cut(s) 70
PceI AGGCCT 1 cut(s) 127
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
SaqAI TTAA 2 cut(s) 6, 229
Sau3AI GATC 1 cut(s) 149
SchI GAGTC 1 cut(s) 34
SetI ASST 1 cut(s) 78
Sse9I AATT 1 cut(s) 15
SseBI AGGCCT 1 cut(s) 127
SspMI CTAG 1 cut(s) 138
StuI AGGCCT 1 cut(s) 127
TaqI TCGA 2 cut(s) 43, 148
TasI AATT 1 cut(s) 15
Tru1I TTAA 2 cut(s) 6, 229
Tru9I TTAA 2 cut(s) 6, 229
TspDTI ATGAA 3 cut(s) 65, 75, 177
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.