Rmu_sc0002833.1_g000051

Conserved gene of

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002833.1
Physical Location & Seq
Forward (+)
239088 .. 239568
481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002833.1_g000051.1.cds

Sequence Viewer

Length: 411 bp
atgcgaactgaaacaactcaacctgatggaattcggacaatgacagatgatgaaatttgtgcaaaagtcctcggcgtcaaatcaggctacatcaagggttgtggttttggccctagacctccaccattaagggtctctcatttgtcaataaatgaaatgtctgaaaagaacaaagagttgcaagaacagcttcaggagacccaacaccttgtaggggctcaacaacaaaagattgatgcacaaaatgagaacaaagagttgcaagaacagcttcaggagacccaacaccttgtaggggctcaacaacaaaagattgatgcacaaaatgaggtgatccaaagattggaggagcaagccaaaaagtttgaggagtttatggctaacttttccaagcaacatccatcaagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.5

Weight (kDa)

5.4

Isoelectric Point (pI)

51.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 343
AclWI GGATC 1 cut(s) 328
AcsI RAATTY 2 cut(s) 30, 54
AcuI CTGAAG 2 cut(s) 176, 257
AcyI GRCGYC 1 cut(s) 75
AfiI CCNNNNNNNGG 3 cut(s) 214, 295, 343
AluBI AGCT 2 cut(s) 190, 271
AluI AGCT 2 cut(s) 190, 271
Alw26I GTCTC 3 cut(s) 139, 191, 272
AlwI GGATC 1 cut(s) 328
AoxI GGCC 1 cut(s) 109
ApoI RAATTY 2 cut(s) 30, 54
Asp700I GAANNNNTTC 2 cut(s) 189, 270
AspS9I GGNCC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 343
BanII GRGCYC 2 cut(s) 220, 301
BccI CCATC 2 cut(s) 20, 409
BcoDI GTCTC 3 cut(s) 139, 191, 272
BfaI CTAG 1 cut(s) 114
BmgT120I GGNCC 1 cut(s) 110
BmsI GCATC 2 cut(s) 226, 307
BsaHI GRCGYC 1 cut(s) 75
BsaI GGTCTC 3 cut(s) 139, 191, 272
BsaJI CCNNGG 1 cut(s) 70
Bsc4I CCNNNNNNNGG 3 cut(s) 214, 295, 343
BseDI CCNNGG 1 cut(s) 70
BseGI GGATG 1 cut(s) 397
BseLI CCNNNNNNNGG 3 cut(s) 214, 295, 343
BseRI GAGGAG 2 cut(s) 362, 383
BshFI GGCC 1 cut(s) 111
BslI CCNNNNNNNGG 3 cut(s) 214, 295, 343
BsmAI GTCTC 3 cut(s) 139, 191, 272
BsnI GGCC 1 cut(s) 111
Bso31I GGTCTC 3 cut(s) 139, 191, 272
Bsp1286I GDGCHC 2 cut(s) 220, 301
Bsp143I GATC 1 cut(s) 333
BspANI GGCC 1 cut(s) 111
BspPI GGATC 1 cut(s) 328
BspTNI GGTCTC 3 cut(s) 139, 191, 272
BssECI CCNNGG 1 cut(s) 70
BssMI GATC 1 cut(s) 333
BssNI GRCGYC 1 cut(s) 75
BstACI GRCGYC 1 cut(s) 75
BstC8I GCNNGC 1 cut(s) 354
BstF5I GGATG 1 cut(s) 397
BstKTI GATC 1 cut(s) 336
BstMAI GTCTC 3 cut(s) 139, 191, 272
BstMBI GATC 1 cut(s) 333
BstMWI GCNNNNNNNGC 2 cut(s) 187, 268
BsuRI GGCC 1 cut(s) 111
BtsCI GGATG 1 cut(s) 397
Cac8I GCNNGC 1 cut(s) 354
Cfr13I GGNCC 1 cut(s) 110
CseI GACGC 1 cut(s) 64
CspCI CAANNNNNGTGG 2 cut(s) 82, 117
CviJI RGCY 8 cut(s) 87, 111, 190, 218, 271, 299, 356, 380
CviKI_1 RGCY 8 cut(s) 87, 111, 190, 218, 271, 299, 356, 380
DpnI GATC 1 cut(s) 335
DpnII GATC 1 cut(s) 333
Eco24I GRGCYC 2 cut(s) 220, 301
Eco31I GGTCTC 3 cut(s) 139, 191, 272
Eco57I CTGAAG 2 cut(s) 176, 257
EcoRI GAATTC 1 cut(s) 30
EcoT38I GRGCYC 2 cut(s) 220, 301
FaiI YATR 1 cut(s) 377
FalI AAGNNNNNCTT 4 cut(s) 174, 206, 255, 287
FokI GGATG 1 cut(s) 384
FriOI GRGCYC 2 cut(s) 220, 301
FspBI CTAG 1 cut(s) 114
HaeIII GGCC 1 cut(s) 111
HgaI GACGC 1 cut(s) 64
Hin1I GRCGYC 1 cut(s) 75
HphI GGTGA 1 cut(s) 343
Hpy188I TCNGA 2 cut(s) 36, 163
Hpy188III TCNNGA 2 cut(s) 194, 275
HpyCH4V TGCA 5 cut(s) 62, 181, 239, 262, 320
HpyF10VI GCNNNNNNNGC 2 cut(s) 187, 268
Hsp92I GRCGYC 1 cut(s) 75
Kzo9I GATC 1 cut(s) 333
LmnI GCTCC 1 cut(s) 349
LpnPI CCDG 4 cut(s) 36, 69, 179, 260
LweI GCATC 2 cut(s) 226, 307
MaeI CTAG 1 cut(s) 114
MalI GATC 1 cut(s) 335
MboI GATC 1 cut(s) 333
MhlI GDGCHC 2 cut(s) 220, 301
MluCI AATT 2 cut(s) 30, 54
MnlI CCTC 5 cut(s) 80, 129, 322, 340, 361
MroXI GAANNNNTTC 2 cut(s) 189, 270
MseI TTAA 1 cut(s) 128
MwoI GCNNNNNNNGC 2 cut(s) 187, 268
NdeII GATC 1 cut(s) 333
NmeAIII GCCGAG 1 cut(s) 51
PdmI GAANNNNTTC 2 cut(s) 189, 270
PflMI CCANNNNNTGG 1 cut(s) 343
PspPI GGNCC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 1 cut(s) 333
Sau96I GGNCC 1 cut(s) 110
SduI GDGCHC 2 cut(s) 220, 301
SetI ASST 7 cut(s) 25, 121, 192, 210, 273, 291, 333
SfaNI GCATC 2 cut(s) 226, 307
Sse9I AATT 2 cut(s) 30, 54
SspMI CTAG 1 cut(s) 114
TasI AATT 2 cut(s) 30, 54
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 66, 168
Van91I CCANNNNNTGG 1 cut(s) 343
XapI RAATTY 2 cut(s) 30, 54
XmnI GAANNNNTTC 2 cut(s) 189, 270
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.