Rmu_sc0001307.1_g000027

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001307.1
Physical Location & Seq
Reverse (-)
153720 .. 154049
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001307.1_g000027.1.cds

Sequence Viewer

Length: 330 bp
atgcgaattgagacaactcaacttgatggaactcagacaatgacagatgatgaaatttgtgcaaaagtcctcagagtcaaatcaggctacatcaagggttgtggttttggccctagacatccaccatcaaaggtctctcattcatcgataaatgaaatgtctgaaaagaacaaagagttgcaagaacagcttcaagagatccaacacgtagtagggactcaacaacaaaagattgatgcacaaaatgaggtgatccaaagattggaggagcaagctaaaaagtttgaggagttcatggctaacttttccaggcaacatccatcaagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.47

Weight (kDa)

6.07

Isoelectric Point (pI)

52.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 262
AclWI GGATC 2 cut(s) 193, 247
AcsI RAATTY 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 262
AflIII ACRYGT 1 cut(s) 205
AgsI TTSAA 1 cut(s) 194
AjnI CCWGG 1 cut(s) 308
AluBI AGCT 2 cut(s) 190, 275
AluI AGCT 2 cut(s) 190, 275
Alw26I GTCTC 2 cut(s) 5, 139
AlwI GGATC 2 cut(s) 193, 247
AoxI GGCC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 54
Asp700I GAANNNNTTC 1 cut(s) 189
AspS9I GGNCC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 262
BccI CCATC 3 cut(s) 20, 133, 328
BciT130I CCWGG 1 cut(s) 310
BcoDI GTCTC 2 cut(s) 5, 139
BfaI CTAG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 310
BmgT120I GGNCC 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 310
BmsI GCATC 1 cut(s) 226
Bsa29I ATCGAT 1 cut(s) 146
BsaAI YACGTR 1 cut(s) 208
BsaI GGTCTC 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 262
BseBI CCWGG 1 cut(s) 310
BseCI ATCGAT 1 cut(s) 146
BseGI GGATG 2 cut(s) 118, 316
BseLI CCNNNNNNNGG 1 cut(s) 262
BseMII CTCAG 2 cut(s) 47, 85
BseRI GAGGAG 2 cut(s) 281, 302
BshFI GGCC 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 146
BslFI GGGAC 1 cut(s) 229
BslI CCNNNNNNNGG 1 cut(s) 262
BsmAI GTCTC 2 cut(s) 5, 139
BsmFI GGGAC 1 cut(s) 229
BsnI GGCC 1 cut(s) 111
Bso31I GGTCTC 1 cut(s) 139
Bsp143I GATC 2 cut(s) 198, 252
BspANI GGCC 1 cut(s) 111
BspCNI CTCAG 2 cut(s) 46, 84
BspDI ATCGAT 1 cut(s) 146
BspPI GGATC 2 cut(s) 193, 247
BspTNI GGTCTC 1 cut(s) 139
BssMI GATC 2 cut(s) 198, 252
Bst2UI CCWGG 1 cut(s) 310
BstBAI YACGTR 1 cut(s) 208
BstC8I GCNNGC 1 cut(s) 273
BstDEI CTNAG 2 cut(s) 33, 71
BstF5I GGATG 2 cut(s) 118, 316
BstKTI GATC 2 cut(s) 201, 255
BstMAI GTCTC 2 cut(s) 5, 139
BstMBI GATC 2 cut(s) 198, 252
BstMWI GCNNNNNNNGC 1 cut(s) 187
BstNI CCWGG 1 cut(s) 310
BstSCI CCNGG 1 cut(s) 308
BstX2I RGATCY 1 cut(s) 198
BstYI RGATCY 1 cut(s) 198
Bsu15I ATCGAT 1 cut(s) 146
BsuRI GGCC 1 cut(s) 111
BsuTUI ATCGAT 1 cut(s) 146
BtsCI GGATG 2 cut(s) 118, 316
Cac8I GCNNGC 1 cut(s) 273
Cfr13I GGNCC 1 cut(s) 110
ClaI ATCGAT 1 cut(s) 146
CspCI CAANNNNNGTGG 2 cut(s) 82, 117
CviAII CATG 1 cut(s) 295
CviJI RGCY 5 cut(s) 87, 111, 190, 275, 299
CviKI_1 RGCY 5 cut(s) 87, 111, 190, 275, 299
DdeI CTNAG 2 cut(s) 33, 71
DpnI GATC 2 cut(s) 200, 254
DpnII GATC 2 cut(s) 198, 252
Eco31I GGTCTC 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 308
FaeI CATG 1 cut(s) 298
FaiI YATR 1 cut(s) 296
FalI AAGNNNNNCTT 2 cut(s) 174, 206
FaqI GGGAC 1 cut(s) 229
FatI CATG 1 cut(s) 294
FokI GGATG 2 cut(s) 105, 303
FspBI CTAG 1 cut(s) 114
HaeIII GGCC 1 cut(s) 111
Hin1II CATG 1 cut(s) 298
HinfI GANTC 2 cut(s) 75, 217
HphI GGTGA 1 cut(s) 262
Hpy188I TCNGA 3 cut(s) 36, 74, 163
Hpy188III TCNNGA 1 cut(s) 194
HpyCH4IV ACGT 1 cut(s) 207
HpyCH4V TGCA 3 cut(s) 62, 181, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 187
HpyF3I CTNAG 2 cut(s) 33, 71
HpySE526I ACGT 1 cut(s) 207
Hsp92II CATG 1 cut(s) 298
Kzo9I GATC 2 cut(s) 198, 252
LmnI GCTCC 1 cut(s) 268
LpnPI CCDG 3 cut(s) 69, 295, 322
LweI GCATC 1 cut(s) 226
MaeI CTAG 1 cut(s) 114
MaeII ACGT 1 cut(s) 207
MalI GATC 2 cut(s) 200, 254
MboI GATC 2 cut(s) 198, 252
MflI RGATCY 1 cut(s) 198
MluCI AATT 2 cut(s) 6, 54
MlyI GAGTC 2 cut(s) 84, 211
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 4 cut(s) 80, 241, 259, 280
MroXI GAANNNNTTC 1 cut(s) 189
MspR9I CCNGG 1 cut(s) 310
MvaI CCWGG 1 cut(s) 310
MwoI GCNNNNNNNGC 1 cut(s) 187
NdeII GATC 2 cut(s) 198, 252
NlaIII CATG 1 cut(s) 298
PdmI GAANNNNTTC 1 cut(s) 189
PflMI CCANNNNNTGG 1 cut(s) 262
PleI GAGTC 2 cut(s) 83, 211
PpsI GAGTC 2 cut(s) 83, 211
Ppu21I YACGTR 1 cut(s) 208
Psp6I CCWGG 1 cut(s) 308
PspGI CCWGG 1 cut(s) 308
PspPI GGNCC 1 cut(s) 110
PsuI RGATCY 1 cut(s) 198
Sau3AI GATC 2 cut(s) 198, 252
Sau96I GGNCC 1 cut(s) 110
SchI GAGTC 2 cut(s) 84, 211
ScrFI CCNGG 1 cut(s) 310
SetI ASST 5 cut(s) 135, 192, 210, 252, 277
SfaNI GCATC 1 cut(s) 226
Sse9I AATT 2 cut(s) 6, 54
SspMI CTAG 1 cut(s) 114
StyD4I CCNGG 1 cut(s) 308
TaiI ACGT 1 cut(s) 210
TaqI TCGA 1 cut(s) 146
TasI AATT 2 cut(s) 6, 54
TspDTI ATGAA 4 cut(s) 66, 132, 168, 283
Van91I CCANNNNNTGG 1 cut(s) 262
XapI RAATTY 1 cut(s) 54
XmnI GAANNNNTTC 1 cut(s) 189
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.