RchiOBHm_Chr2g0148461

TdcA1-ORF2 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0000224
Physical Location & Seq
Forward (+)
66211629 .. 66212126
498 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51803

Sequence Viewer

Length: 288 bp
ATGTGTACTTCATTAATTAAGAATTATGTTAAAGGTCTAAGAAAAAAGGTGCGGGGAAAGACAAGAGGAGTTAATGTAGATAAGGTGCTTTCCCAGTTGAATGCTAAAATACCTGTCACTCTGACCGAGCAAAATGGCAGGCCTACAGGCCCATATGCTGAAATGTTGGCCAATGAAATTGGTTTCACAGTTCGAAACCATGCCCCACTAAATGTGGAAAAATGGAAGAAGATTCAGAAAACTGAAGTGGATAAGTTAATTAAAAGAATAACGGTGAAACAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21 Transposase_24

Protein Analysis

95

Amino Acids

10.77

Weight (kDa)

10.33

Isoelectric Point (pI)

21.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 52
AcoI YGGCCR 1 cut(s) 168
AcuI CTGAAG 1 cut(s) 264
AfaI GTAC 1 cut(s) 7
AgsI TTSAA 1 cut(s) 100
AoxI GGCC 3 cut(s) 140, 148, 168
AseI ATTAAT 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 286
AsuII TTCGAA 1 cut(s) 193
BalI TGGCCA 1 cut(s) 170
BfmI CTRYAG 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 149
BmrI ACTGGG 1 cut(s) 88
BmuI ACTGGG 1 cut(s) 88
Bpu14I TTCGAA 1 cut(s) 193
BsaXI ACNNNNNCTCC 2 cut(s) 60, 90
Bse1I ACTGG 1 cut(s) 94
BseNI ACTGG 1 cut(s) 94
BseRI GAGGAG 1 cut(s) 81
BshFI GGCC 3 cut(s) 142, 150, 170
BsmI GAATGC 1 cut(s) 106
BsnI GGCC 3 cut(s) 142, 150, 170
Bsp119I TTCGAA 1 cut(s) 193
BspACI CCGC 1 cut(s) 52
BspANI GGCC 3 cut(s) 142, 150, 170
BspT104I TTCGAA 1 cut(s) 193
BsrI ACTGG 1 cut(s) 94
Bst4CI ACNGT 2 cut(s) 190, 274
BstBI TTCGAA 1 cut(s) 193
BstC8I GCNNGC 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 38
BstSFI CTRYAG 1 cut(s) 144
BsuRI GGCC 3 cut(s) 142, 150, 170
Cac8I GCNNGC 1 cut(s) 140
Cfr13I GGNCC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 6
CviAII CATG 1 cut(s) 200
CviJI RGCY 3 cut(s) 142, 150, 170
CviKI_1 RGCY 3 cut(s) 142, 150, 170
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 1 cut(s) 38
EaeI YGGCCR 1 cut(s) 168
Eco147I AGGCCT 1 cut(s) 142
Eco57I CTGAAG 1 cut(s) 264
FaeI CATG 1 cut(s) 203
FaiI YATR 4 cut(s) 27, 154, 156, 201
FatI CATG 1 cut(s) 199
FauI CCCGC 1 cut(s) 45
FauNDI CATATG 1 cut(s) 154
HaeIII GGCC 3 cut(s) 142, 150, 170
Hin1II CATG 1 cut(s) 203
HinfI GANTC 1 cut(s) 232
HphI GGTGA 1 cut(s) 286
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 123, 237
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 2 cut(s) 190, 274
HpyF3I CTNAG 1 cut(s) 38
Hsp92II CATG 1 cut(s) 203
LpnPI CCDG 4 cut(s) 107, 124, 126, 132
MaeIII GTNAC 1 cut(s) 115
MboII GAAGA 2 cut(s) 238, 241
MlsI TGGCCA 1 cut(s) 170
MluCI AATT 4 cut(s) 15, 22, 177, 258
MluNI TGGCCA 1 cut(s) 170
MnlI CCTC 1 cut(s) 59
Mox20I TGGCCA 1 cut(s) 170
MscI TGGCCA 1 cut(s) 170
MseI TTAA 6 cut(s) 14, 18, 30, 72, 257, 261
Msp20I TGGCCA 1 cut(s) 170
Mva1269I GAATGC 1 cut(s) 106
NdeI CATATG 1 cut(s) 154
NlaIII CATG 1 cut(s) 203
NmuCI GTSAC 1 cut(s) 115
NspV TTCGAA 1 cut(s) 193
PacI TTAATTAA 2 cut(s) 18, 261
PceI AGGCCT 1 cut(s) 142
PctI GAATGC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 232
PshBI ATTAAT 1 cut(s) 14
PspPI GGNCC 1 cut(s) 149
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
SaqAI TTAA 6 cut(s) 14, 18, 30, 72, 257, 261
Sau96I GGNCC 1 cut(s) 149
SetI ASST 4 cut(s) 37, 51, 87, 115
SfcI CTRYAG 1 cut(s) 144
SfuI TTCGAA 1 cut(s) 193
SgeI CNNG 8 cut(s) 65, 75, 106, 125, 139, 151, 159, 212
Sse9I AATT 4 cut(s) 15, 22, 177, 258
SseBI AGGCCT 1 cut(s) 142
SsiI CCGC 1 cut(s) 52
StuI AGGCCT 1 cut(s) 142
TaaI ACNGT 2 cut(s) 190, 274
TaqI TCGA 1 cut(s) 193
TaqII GACCGA 1 cut(s) 140
TasI AATT 4 cut(s) 15, 22, 177, 258
TatI WGTACW 1 cut(s) 5
TfiI GAWTC 1 cut(s) 232
Tru1I TTAA 6 cut(s) 14, 18, 30, 72, 257, 261
Tru9I TTAA 6 cut(s) 14, 18, 30, 72, 257, 261
TseFI GTSAC 1 cut(s) 115
Tsp45I GTSAC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 189
VspI ATTAAT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.