RLG00000028282

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
20985985 .. 20987995
2011 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000028282

Sequence Viewer

Length: 402 bp
ATGCCTTTTCACAAGATACGTCGTTTCAATGTGTCTAACATCCAAAAGCCTACTACTGGTAATGCACCGAGTAAACGCTCTCGTGTGCGAACTACCAATCAGCCATGCCCAAATGGATCCCATTCTACTTCAGGTACTGCAATGAGTAAACGCTCTCGTGTGCAAACTACTGATCAGCCATGCGGAAATTCTGTAGAAGATGGACTCAATTATGCTATTGGTACCACTACAGAACGAACTACTATTGGGGTCAGAATTAGTTCAGGTCTTCAGCATCAAACTGCTAATAATCAGCTATTGATAAATGTTACAACTGAAGAGCAAAATGATAATGTGATGTCAGCCAGTAATCAAGACCCTCCTACAGGTAGCACAGACTGGAGAGATGCAAGGTGCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

134

Amino Acids

14.55

Weight (kDa)

9.64

Isoelectric Point (pI)

58.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 221
AccB1I GGYRCC 1 cut(s) 221
AciI CCGC 1 cut(s) 183
AclWI GGATC 2 cut(s) 111, 124
AcsI RAATTY 1 cut(s) 187
AcuI CTGAAG 3 cut(s) 114, 254, 336
AfaI GTAC 2 cut(s) 136, 223
AfiI CCNNNNNNNGG 2 cut(s) 56, 365
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 1 cut(s) 295
AluI AGCT 1 cut(s) 295
AlwI GGATC 2 cut(s) 111, 124
AlwNI CAGNNNCTG 1 cut(s) 137
ApoI RAATTY 1 cut(s) 187
Asp700I GAANNNNTTC 1 cut(s) 259
Asp718I GGTACC 1 cut(s) 221
BamHI GGATCC 1 cut(s) 116
BanI GGYRCC 1 cut(s) 221
BauI CACGAG 2 cut(s) 81, 156
BbsI GAAGAC 1 cut(s) 260
BccI CCATC 1 cut(s) 194
BclI TGATCA 1 cut(s) 172
BfmI CTRYAG 3 cut(s) 192, 228, 363
BmiI GGNNCC 2 cut(s) 118, 223
BmsI GCATC 2 cut(s) 283, 376
BpiI GAAGAC 1 cut(s) 260
BpmI CTGGAG 1 cut(s) 400
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 365
Bse1I ACTGG 3 cut(s) 61, 345, 383
Bse3DI GCAATG 1 cut(s) 147
BseGI GGATG 1 cut(s) 39
BseLI CCNNNNNNNGG 2 cut(s) 56, 365
BseMI GCAATG 1 cut(s) 147
BseNI ACTGG 3 cut(s) 61, 345, 383
BshNI GGYRCC 1 cut(s) 221
BslI CCNNNNNNNGG 2 cut(s) 56, 365
Bsp143I GATC 2 cut(s) 116, 172
BspACI CCGC 1 cut(s) 183
BspLI GGNNCC 2 cut(s) 118, 223
BspPI GGATC 2 cut(s) 111, 124
BspQI GCTCTTC 1 cut(s) 312
BspT107I GGYRCC 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 147
BsrI ACTGG 3 cut(s) 61, 345, 383
BssMI GATC 2 cut(s) 116, 172
BssSI CACGAG 2 cut(s) 81, 156
Bst2BI CACGAG 2 cut(s) 81, 156
Bst6I CTCTTC 1 cut(s) 312
BstENI CCTNNNNNAGG 1 cut(s) 363
BstF5I GGATG 1 cut(s) 39
BstKTI GATC 2 cut(s) 119, 175
BstMBI GATC 2 cut(s) 116, 172
BstSFI CTRYAG 3 cut(s) 192, 228, 363
BstV2I GAAGAC 1 cut(s) 260
BstX2I RGATCY 1 cut(s) 116
BstYI RGATCY 1 cut(s) 116
BtsCI GGATG 1 cut(s) 39
CaiI CAGNNNCTG 1 cut(s) 137
Csp6I GTAC 2 cut(s) 135, 222
CviAII CATG 2 cut(s) 105, 180
CviJI RGCY 5 cut(s) 49, 103, 178, 295, 344
CviKI_1 RGCY 5 cut(s) 49, 103, 178, 295, 344
CviQI GTAC 2 cut(s) 135, 222
DpnI GATC 2 cut(s) 118, 174
DpnII GATC 2 cut(s) 116, 172
Eam1104I CTCTTC 1 cut(s) 312
EarI CTCTTC 1 cut(s) 312
Eco57I CTGAAG 3 cut(s) 114, 254, 336
EcoNI CCTNNNNNAGG 1 cut(s) 363
FaeI CATG 2 cut(s) 108, 183
FaiI YATR 3 cut(s) 106, 181, 213
FatI CATG 2 cut(s) 104, 179
FbaI TGATCA 1 cut(s) 172
FokI GGATG 1 cut(s) 26
GsuI CTGGAG 1 cut(s) 400
Hin1II CATG 2 cut(s) 108, 183
HinfI GANTC 1 cut(s) 204
Hpy166II GTNNAC 2 cut(s) 74, 149
Hpy188I TCNGA 1 cut(s) 254
Hpy188III TCNNGA 1 cut(s) 353
Hpy8I GTNNAC 2 cut(s) 74, 149
Hpy99I CGWCG 1 cut(s) 24
HpyCH4IV ACGT 1 cut(s) 19
HpyCH4V TGCA 5 cut(s) 65, 140, 163, 389, 396
HpySE526I ACGT 1 cut(s) 19
Hsp92II CATG 2 cut(s) 108, 183
KpnI GGTACC 1 cut(s) 225
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 2 cut(s) 116, 172
LguI GCTCTTC 1 cut(s) 312
LpnPI CCDG 6 cut(s) 42, 117, 249, 351, 358, 364
LweI GCATC 2 cut(s) 283, 376
MaeII ACGT 1 cut(s) 19
MaeIII GTNAC 1 cut(s) 307
MalI GATC 2 cut(s) 118, 174
MboI GATC 2 cut(s) 116, 172
MboII GAAGA 3 cut(s) 209, 260, 329
MfeI CAATTG 1 cut(s) 397
MflI RGATCY 1 cut(s) 116
MluCI AATT 4 cut(s) 187, 208, 255, 397
MlyI GAGTC 1 cut(s) 198
MnlI CCTC 1 cut(s) 369
MroXI GAANNNNTTC 1 cut(s) 259
MunI CAATTG 1 cut(s) 397
NdeII GATC 2 cut(s) 116, 172
NlaIII CATG 2 cut(s) 108, 183
NlaIV GGNNCC 2 cut(s) 118, 223
PciSI GCTCTTC 1 cut(s) 312
PdmI GAANNNNTTC 1 cut(s) 259
PleI GAGTC 1 cut(s) 198
PpsI GAGTC 1 cut(s) 198
PspN4I GGNNCC 2 cut(s) 118, 223
PstNI CAGNNNCTG 1 cut(s) 137
PsuI RGATCY 1 cut(s) 116
RsaI GTAC 2 cut(s) 136, 223
RsaNI GTAC 2 cut(s) 135, 222
SapI GCTCTTC 1 cut(s) 312
Sau3AI GATC 2 cut(s) 116, 172
SchI GAGTC 1 cut(s) 198
SetI ASST 6 cut(s) 22, 136, 268, 297, 370, 395
SfaNI GCATC 2 cut(s) 283, 376
SfcI CTRYAG 3 cut(s) 192, 228, 363
Sse9I AATT 4 cut(s) 187, 208, 255, 397
SsiI CCGC 1 cut(s) 183
TaiI ACGT 1 cut(s) 22
TasI AATT 4 cut(s) 187, 208, 255, 397
XagI CCTNNNNNAGG 1 cut(s) 363
XapI RAATTY 1 cut(s) 187
XmnI GAANNNNTTC 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.