Rroxscaffold_4G00310820

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000224
Physical Location & Seq
Forward (+)
32926934 .. 32957947
31014 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00310820.1

Sequence Viewer

Length: 729 bp
ATGATGTCAAGACTCGGGAAGAATGGGAGTTTCTCTCGTGCTCGTTTTTCTAGTGAAAAGTTTCAGGTCGAGTCCTCGGAGTCAAATCGAGGCTACATCAAGGGTTGTGGTTTTGGCCCAAGACCTCCACCATCAAGGGTCTCTCATTCGTCGATAAATGAAATGTCTGAAAAGAACAAAGAGTTGCAAGAACAGCTTCAAGAGACCCAACACCTTGTAGGGACTCAACAACAAAAGATTGATGCACAAAATGAGGTGATCCAAAGATTGCAGGAGCAAGCCAAAAAGTTTGAGGAGTTCATGGCTAACTTTTCCAGGCAACATCCATCAAGTATGAGGCTCAGTTTGAGACATGATGAATTTACTGATTCATGCTCGGGCGTGAATGATAAATTTTCTCAACATGAATTACCCGTTGTACTTCAGGCCTCGATTCCTGCTTGGAGAGTTGTTAAGAACATCAAGCCGGATTCACTGGTTCAAGAATCACTCAAAACGAAGCTCTATAACTCGAGATATCTTGATCGAAATCTTCGGCTTCCAAAGGACACATTACTCGAAAAGAGTTTTAGGTTGAGGCGTGTAAACACTGCCCTTAAGAGTAGATTTCGCCCCTCGGAGACAATGTCTCGGTGTAGCAGATCGGAGCGCGGGATTGGTGAGGTCAAAGACCAAGGCGTCGTTGAGGGTTGCAAGAAAGGCTCTTTGCTCTTGCAATTAAACGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

242

Amino Acids

27.75

Weight (kDa)

9.79

Isoelectric Point (pI)

58.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 677
AccII CGCG 1 cut(s) 651
AciI CCGC 1 cut(s) 651
AclWI GGATC 1 cut(s) 253
AcsI RAATTY 2 cut(s) 359, 392
AcuI CTGAAG 1 cut(s) 407
AcyI GRCGYC 1 cut(s) 678
AfaI GTAC 1 cut(s) 420
AflII CTTAAG 1 cut(s) 596
AgsI TTSAA 2 cut(s) 200, 482
AjnI CCWGG 1 cut(s) 314
AluBI AGCT 2 cut(s) 196, 502
AluI AGCT 2 cut(s) 196, 502
Alw21I GWGCWC 1 cut(s) 43
Alw26I GTCTC 5 cut(s) 145, 197, 343, 614, 633
AlwI GGATC 1 cut(s) 253
Ama87I CYCGRG 3 cut(s) 14, 376, 511
AoxI GGCC 2 cut(s) 115, 426
ApoI RAATTY 2 cut(s) 359, 392
Asp700I GAANNNNTTC 2 cut(s) 60, 195
AspLEI GCGC 1 cut(s) 651
AspS9I GGNCC 1 cut(s) 116
AsuHPI GGTGA 2 cut(s) 268, 671
AvaI CYCGRG 3 cut(s) 14, 376, 511
BauI CACGAG 1 cut(s) 36
Bbv12I GWGCWC 1 cut(s) 43
BccI CCATC 2 cut(s) 139, 334
BciT130I CCWGG 1 cut(s) 316
BcoDI GTCTC 5 cut(s) 145, 197, 343, 614, 633
BfaI CTAG 2 cut(s) 51, 727
BfrI CTTAAG 1 cut(s) 596
Bme1390I CCNGG 1 cut(s) 316
BmeT110I CYCGRG 3 cut(s) 14, 376, 511
BmgT120I GGNCC 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 316
BmsI GCATC 1 cut(s) 232
BplI GAGNNNNNCTC 2 cut(s) 19, 51
BsaBI GATNNNNATC 1 cut(s) 528
BsaHI GRCGYC 1 cut(s) 678
BsaI GGTCTC 2 cut(s) 145, 197
BsaJI CCNNGG 3 cut(s) 75, 615, 673
BsaXI ACNNNNNCTCC 2 cut(s) 611, 641
Bse1I ACTGG 1 cut(s) 480
Bse8I GATNNNNATC 1 cut(s) 528
BseBI CCWGG 1 cut(s) 316
BseDI CCNNGG 3 cut(s) 75, 615, 673
BseGI GGATG 1 cut(s) 322
BseJI GATNNNNATC 1 cut(s) 528
BseMII CTCAG 1 cut(s) 355
BseNI ACTGG 1 cut(s) 480
BseRI GAGGAG 1 cut(s) 308
Bsh1236I CGCG 1 cut(s) 651
BshFI GGCC 2 cut(s) 117, 428
BsiHKAI GWGCWC 1 cut(s) 43
BsiHKCI CYCGRG 3 cut(s) 14, 376, 511
BsiSI CCGG 1 cut(s) 467
BslFI GGGAC 1 cut(s) 235
BsmAI GTCTC 5 cut(s) 145, 197, 343, 614, 633
BsmFI GGGAC 1 cut(s) 235
BsnI GGCC 2 cut(s) 117, 428
Bso31I GGTCTC 2 cut(s) 145, 197
BsoBI CYCGRG 3 cut(s) 14, 376, 511
Bsp1286I GDGCHC 1 cut(s) 43
Bsp143I GATC 3 cut(s) 258, 523, 641
BspACI CCGC 1 cut(s) 651
BspANI GGCC 2 cut(s) 117, 428
BspCNI CTCAG 1 cut(s) 354
BspFNI CGCG 1 cut(s) 651
BspPI GGATC 1 cut(s) 253
BspTI CTTAAG 1 cut(s) 596
BspTNI GGTCTC 2 cut(s) 145, 197
BsrI ACTGG 1 cut(s) 480
BssECI CCNNGG 3 cut(s) 75, 615, 673
BssMI GATC 3 cut(s) 258, 523, 641
BssNI GRCGYC 1 cut(s) 678
BssSI CACGAG 1 cut(s) 36
BssT1I CCWWGG 1 cut(s) 673
Bst2BI CACGAG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 316
BstACI GRCGYC 1 cut(s) 678
BstAFI CTTAAG 1 cut(s) 596
BstC8I GCNNGC 1 cut(s) 279
BstDEI CTNAG 1 cut(s) 341
BstF5I GGATG 1 cut(s) 322
BstFNI CGCG 1 cut(s) 651
BstHHI GCGC 1 cut(s) 651
BstKTI GATC 3 cut(s) 261, 526, 644
BstMAI GTCTC 5 cut(s) 145, 197, 343, 614, 633
BstMBI GATC 3 cut(s) 258, 523, 641
BstMWI GCNNNNNNNGC 2 cut(s) 193, 699
BstNI CCWGG 1 cut(s) 316
BstSCI CCNGG 1 cut(s) 314
BstUI CGCG 1 cut(s) 651
BsuRI GGCC 2 cut(s) 117, 428
BtsCI GGATG 1 cut(s) 322
BtsI GCAGTG 1 cut(s) 588
BtsIMutI CAGTG 2 cut(s) 473, 588
Cac8I GCNNGC 1 cut(s) 279
CfoI GCGC 1 cut(s) 651
Cfr13I GGNCC 1 cut(s) 116
CseI GACGC 1 cut(s) 667
Csp6I GTAC 1 cut(s) 419
CspCI CAANNNNNGTGG 2 cut(s) 88, 123
CviAII CATG 4 cut(s) 301, 353, 372, 404
CviQI GTAC 1 cut(s) 419
DdeI CTNAG 1 cut(s) 341
DpnI GATC 3 cut(s) 260, 525, 643
DpnII GATC 3 cut(s) 258, 523, 641
DrdI GACNNNNNNGTC 1 cut(s) 677
DseDI GACNNNNNNGTC 1 cut(s) 677
Eco130I CCWWGG 1 cut(s) 673
Eco147I AGGCCT 1 cut(s) 428
Eco31I GGTCTC 2 cut(s) 145, 197
Eco32I GATATC 1 cut(s) 518
Eco57I CTGAAG 1 cut(s) 407
Eco88I CYCGRG 3 cut(s) 14, 376, 511
EcoRII CCWGG 1 cut(s) 314
EcoRV GATATC 1 cut(s) 518
EcoT14I CCWWGG 1 cut(s) 673
ErhI CCWWGG 1 cut(s) 673
FaeI CATG 4 cut(s) 304, 356, 375, 407
FaiI YATR 6 cut(s) 302, 335, 354, 373, 405, 507
FalI AAGNNNNNCTT 2 cut(s) 180, 212
FaqI GGGAC 1 cut(s) 235
FatI CATG 4 cut(s) 300, 352, 371, 403
FauI CCCGC 1 cut(s) 644
FokI GGATG 1 cut(s) 309
FspBI CTAG 2 cut(s) 51, 727
GlaI GCGC 1 cut(s) 650
HaeIII GGCC 2 cut(s) 117, 428
HapII CCGG 1 cut(s) 467
HgaI GACGC 1 cut(s) 667
HhaI GCGC 1 cut(s) 651
Hin1I GRCGYC 1 cut(s) 678
Hin1II CATG 4 cut(s) 304, 356, 375, 407
Hin6I GCGC 1 cut(s) 649
HinP1I GCGC 1 cut(s) 649
HinfI GANTC 8 cut(s) 12, 71, 80, 223, 368, 433, 470, 485
HpaII CCGG 1 cut(s) 467
HphI GGTGA 2 cut(s) 268, 671
Hpy166II GTNNAC 1 cut(s) 586
Hpy188I TCNGA 4 cut(s) 79, 169, 619, 646
Hpy188III TCNNGA 6 cut(s) 9, 16, 200, 482, 513, 521
Hpy8I GTNNAC 1 cut(s) 586
Hpy99I CGWCG 2 cut(s) 154, 683
HpyCH4IV ACGT 1 cut(s) 723
HpyCH4V TGCA 5 cut(s) 187, 245, 271, 693, 715
HpyF10VI GCNNNNNNNGC 2 cut(s) 193, 699
HpyF3I CTNAG 1 cut(s) 341
HpySE526I ACGT 1 cut(s) 723
Hsp92I GRCGYC 1 cut(s) 678
Hsp92II CATG 4 cut(s) 304, 356, 375, 407
HspAI GCGC 1 cut(s) 649
Kzo9I GATC 3 cut(s) 258, 523, 641
LmnI GCTCC 2 cut(s) 274, 646
LpnPI CCDG 8 cut(s) 50, 257, 301, 328, 410, 450, 461, 480
LweI GCATC 1 cut(s) 232
MaeI CTAG 2 cut(s) 51, 727
MaeII ACGT 1 cut(s) 723
MalI GATC 3 cut(s) 260, 525, 643
MboI GATC 3 cut(s) 258, 523, 641
MboII GAAGA 2 cut(s) 31, 524
MhlI GDGCHC 1 cut(s) 43
MluCI AATT 4 cut(s) 359, 392, 407, 716
MlyI GAGTC 4 cut(s) 6, 80, 89, 217
MroXI GAANNNNTTC 2 cut(s) 60, 195
MseI TTAA 3 cut(s) 453, 597, 719
MspCI CTTAAG 1 cut(s) 596
MspI CCGG 1 cut(s) 467
MspR9I CCNGG 1 cut(s) 316
MvaI CCWGG 1 cut(s) 316
MvnI CGCG 1 cut(s) 651
MwoI GCNNNNNNNGC 2 cut(s) 193, 699
NdeII GATC 3 cut(s) 258, 523, 641
NlaIII CATG 4 cut(s) 304, 356, 375, 407
PaeR7I CTCGAG 1 cut(s) 511
PceI AGGCCT 1 cut(s) 428
PdmI GAANNNNTTC 2 cut(s) 60, 195
PfeI GAWTC 4 cut(s) 368, 433, 470, 485
PflFI GACNNNGTC 1 cut(s) 625
PleI GAGTC 4 cut(s) 6, 79, 88, 217
PpsI GAGTC 4 cut(s) 6, 79, 88, 217
Psp6I CCWGG 1 cut(s) 314
PspGI CCWGG 1 cut(s) 314
PspPI GGNCC 1 cut(s) 116
PsyI GACNNNGTC 1 cut(s) 625
RsaI GTAC 1 cut(s) 420
RsaNI GTAC 1 cut(s) 419
SaqAI TTAA 3 cut(s) 453, 597, 719
Sau3AI GATC 3 cut(s) 258, 523, 641
Sau96I GGNCC 1 cut(s) 116
SchI GAGTC 4 cut(s) 6, 80, 89, 217
ScrFI CCNGG 1 cut(s) 316
SduI GDGCHC 1 cut(s) 43
SetI ASST 9 cut(s) 69, 127, 198, 216, 258, 504, 575, 666, 726
SfaNI GCATC 1 cut(s) 232
Sfr274I CTCGAG 1 cut(s) 511
SlaI CTCGAG 1 cut(s) 511
SmlI CTYRAG 2 cut(s) 511, 596
SmoI CTYRAG 2 cut(s) 511, 596
Sse9I AATT 4 cut(s) 359, 392, 407, 716
SseBI AGGCCT 1 cut(s) 428
SsiI CCGC 1 cut(s) 651
SspMI CTAG 2 cut(s) 51, 727
StuI AGGCCT 1 cut(s) 428
StyD4I CCNGG 1 cut(s) 314
StyI CCWWGG 1 cut(s) 673
TaiI ACGT 1 cut(s) 726
TaqI TCGA 7 cut(s) 69, 88, 152, 431, 512, 526, 558
TasI AATT 4 cut(s) 359, 392, 407, 716
TatI WGTACW 1 cut(s) 418
TfiI GAWTC 4 cut(s) 368, 433, 470, 485
Tru1I TTAA 3 cut(s) 453, 597, 719
Tru9I TTAA 3 cut(s) 453, 597, 719
TscAI CASTG 2 cut(s) 480, 595
TspDTI ATGAA 5 cut(s) 174, 289, 360, 372, 420
TspRI CASTG 2 cut(s) 480, 595
Tth111I GACNNNGTC 1 cut(s) 625
Vha464I CTTAAG 1 cut(s) 596
XapI RAATTY 2 cut(s) 359, 392
XhoI CTCGAG 1 cut(s) 511
XmnI GAANNNNTTC 2 cut(s) 60, 195
XspI CTAG 2 cut(s) 51, 727
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.