Rroxscaffold_8G00436860

TdcA1-ORF2 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000008
OG0000224
Physical Location & Seq
Forward (+)
77217 .. 77708
492 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_8G00436860.1

Sequence Viewer

Length: 342 bp
ATGGCGGCATTTTGTAAATTCCGTTATAGGCTAAAGAAGTATTTTGAGAAATACTCAACAGTGGATGAAGCACGAGAAAACAAGCCTGAAGCAGTTAAAACTCAAGCAGAATGGGATTTTCTTTGTATTTGTTTTTCTAGAGAAGAGTTACAGATCAATACACAGAATGCTGACAAGAAGTTGCATTTGACATATCACCACAATGCTTGGTTGAAGTATTTCATATCCCATGAAGATGAGATTGTAAGATCTGAAGAACTGAAGGAGCATGCCAAAATAATTGAAGAACTGAAGGAGGATGCCAAAAGAATGCAAGAATTGATTGCAAAATTTCCAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21 Transposase_24

Protein Analysis

113

Amino Acids

13.67

Weight (kDa)

6.52

Isoelectric Point (pI)

38.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AcsI RAATTY 2 cut(s) 17, 329
AcuI CTGAAG 4 cut(s) 108, 273, 281, 311
AgsI TTSAA 2 cut(s) 214, 284
AluBI AGCT 1 cut(s) 338
AluI AGCT 1 cut(s) 338
ApoI RAATTY 2 cut(s) 17, 329
Asp700I GAANNNNTTC 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 188
BauI CACGAG 1 cut(s) 72
BfaI CTAG 1 cut(s) 138
BglII AGATCT 1 cut(s) 248
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BmsI GCATC 1 cut(s) 289
BplI GAGNNNNNCTC 2 cut(s) 38, 70
BpuEI CTTGAG 1 cut(s) 87
BseGI GGATG 2 cut(s) 70, 304
BsmI GAATGC 2 cut(s) 172, 315
Bsp143I GATC 2 cut(s) 153, 248
BspACI CCGC 1 cut(s) 5
BssMI GATC 2 cut(s) 153, 248
BssSI CACGAG 1 cut(s) 72
Bst2BI CACGAG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 61
Bst6I CTCTTC 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 270
BstF5I GGATG 2 cut(s) 70, 304
BstKTI GATC 2 cut(s) 156, 251
BstMBI GATC 2 cut(s) 153, 248
BstNSI RCATGY 1 cut(s) 272
BstX2I RGATCY 1 cut(s) 248
BstYI RGATCY 1 cut(s) 248
BtsCI GGATG 2 cut(s) 70, 304
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 270
CspCI CAANNNNNGTGG 2 cut(s) 188, 223
CviAII CATG 2 cut(s) 230, 269
CviJI RGCY 3 cut(s) 31, 85, 338
CviKI_1 RGCY 3 cut(s) 31, 85, 338
DpnI GATC 2 cut(s) 155, 250
DpnII GATC 2 cut(s) 153, 248
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco57I CTGAAG 4 cut(s) 108, 273, 281, 311
FaeI CATG 2 cut(s) 233, 272
FaiI YATR 5 cut(s) 27, 193, 224, 231, 270
FatI CATG 2 cut(s) 229, 268
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 2 cut(s) 77, 311
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 1 cut(s) 138
GluI GCNGC 1 cut(s) 6
Hin1II CATG 2 cut(s) 233, 272
HphI GGTGA 1 cut(s) 188
Hpy188I TCNGA 1 cut(s) 253
Hpy188III TCNNGA 1 cut(s) 138
HpyAV CCTTC 2 cut(s) 256, 286
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4V TGCA 3 cut(s) 184, 313, 326
Hsp92II CATG 2 cut(s) 233, 272
Kzo9I GATC 2 cut(s) 153, 248
LmnI GCTCC 1 cut(s) 265
LpnPI CCDG 1 cut(s) 99
LweI GCATC 1 cut(s) 289
MaeI CTAG 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 147
MalI GATC 2 cut(s) 155, 250
MboI GATC 2 cut(s) 153, 248
MboII GAAGA 4 cut(s) 155, 245, 266, 296
MflI RGATCY 1 cut(s) 248
MluCI AATT 4 cut(s) 17, 279, 317, 329
MnlI CCTC 1 cut(s) 289
MroXI GAANNNNTTC 1 cut(s) 218
MseI TTAA 2 cut(s) 96, 340
MslI CAYNNNNRTG 2 cut(s) 201, 234
Mva1269I GAATGC 2 cut(s) 172, 315
NdeII GATC 2 cut(s) 153, 248
NlaIII CATG 2 cut(s) 233, 272
NspI RCATGY 1 cut(s) 272
PaeI GCATGC 1 cut(s) 272
PctI GAATGC 2 cut(s) 172, 315
PdmI GAANNNNTTC 1 cut(s) 218
PkrI GCNGC 1 cut(s) 7
PsuI RGATCY 1 cut(s) 248
RseI CAYNNNNRTG 2 cut(s) 201, 234
SaqAI TTAA 2 cut(s) 96, 340
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 2 cut(s) 153, 248
SetI ASST 1 cut(s) 340
SfaNI GCATC 1 cut(s) 289
SmiMI CAYNNNNRTG 2 cut(s) 201, 234
SmlI CTYRAG 1 cut(s) 102
SmoI CTYRAG 1 cut(s) 102
SphI GCATGC 1 cut(s) 272
Sse9I AATT 4 cut(s) 17, 279, 317, 329
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 138
TaaI ACNGT 1 cut(s) 61
TasI AATT 4 cut(s) 17, 279, 317, 329
TauI GCSGC 1 cut(s) 8
Tru1I TTAA 2 cut(s) 96, 340
Tru9I TTAA 2 cut(s) 96, 340
TscAI CASTG 1 cut(s) 66
TspDTI ATGAA 3 cut(s) 81, 211, 246
TspGWI ACGGA 1 cut(s) 11
TspRI CASTG 1 cut(s) 66
XapI RAATTY 2 cut(s) 17, 329
XbaI TCTAGA 1 cut(s) 137
XceI RCATGY 1 cut(s) 272
XmnI GAANNNNTTC 1 cut(s) 218
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.