Rmu_sc0002365.1_g000027

TdcA1-ORF2 protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002365.1
Physical Location & Seq
Forward (+)
136025 .. 137084
1060 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002365.1_g000027.1.cds

Sequence Viewer

Length: 744 bp
atgtgtcttcattatcaaactcttcacaagccgttgactattgctacaactgacgagttaaatgatattgtaacgtcagtgaatattcaaaggtctactataggtctagaaagagaagtgaggcgaaagacaagacggttgaattctgagaagctgcattctcagcttaatgctaaaataccggtcactttgatacaacataatgaaaggcccacaggtccatatgcagaattgttcgtgaatgatattagcttaatagttaggaactttgcacctatgaatgtggaaaaatggaatgacattgaaccagcttgtgtgactaagatgattgaaagaataaccagtaagttcgacattaacatgtctcttccttgggtcaagagatacataaacaagatgtgtatggcggcattttgtaaattccgctataggctaaagaagtattttgagaaatactcaacagtggacgaagcacgagaaaacaagcctgaagcagttaaaactcaagcagaatgggattttctttgtattcgtttttctagagaagagttacagatcaatacacagaatgctgacaagaagttgcatttgacatatcaccacaatgcttggtcgaagtatttcatatcccatgaagatgagattgtaagatctgaagaactgaaggagcatgccaaaatatttgaagaactgaaggaggatgccaaaagaatgcaagaattgattgcaaaatttccagcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

247

Amino Acids

29.36

Weight (kDa)

8.84

Isoelectric Point (pI)

50.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 95
AciI CCGC 2 cut(s) 407, 424
AcsI RAATTY 3 cut(s) 142, 419, 731
AcuI CTGAAG 4 cut(s) 510, 675, 683, 713
AflIII ACRYGT 1 cut(s) 360
AgeI ACCGGT 1 cut(s) 181
AgsI TTSAA 5 cut(s) 89, 142, 305, 332, 686
AluBI AGCT 5 cut(s) 154, 166, 252, 311, 740
AluI AGCT 5 cut(s) 154, 166, 252, 311, 740
Alw26I GTCTC 1 cut(s) 369
AoxI GGCC 1 cut(s) 209
ApeKI GCWGC 1 cut(s) 154
ApoI RAATTY 3 cut(s) 142, 419, 731
AsiGI ACCGGT 1 cut(s) 181
Asp700I GAANNNNTTC 1 cut(s) 620
AspS9I GGNCC 2 cut(s) 210, 218
AsuHPI GGTGA 1 cut(s) 590
AvaII GGWCC 1 cut(s) 218
BauI CACGAG 1 cut(s) 474
BbvI GCAGC 1 cut(s) 141
BceAI ACGGC 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 369
BfaI CTAG 2 cut(s) 107, 540
BfmI CTRYAG 2 cut(s) 99, 427
BglII AGATCT 1 cut(s) 650
BisI GCNGC 2 cut(s) 155, 408
BlsI GCNGC 2 cut(s) 156, 409
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 2 cut(s) 210, 218
BmsI GCATC 1 cut(s) 691
BplI GAGNNNNNCTC 2 cut(s) 440, 472
BpuEI CTTGAG 1 cut(s) 489
BsaJI CCNNGG 1 cut(s) 371
BsaWI WCCGGW 1 cut(s) 181
Bse118I RCCGGY 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 342
BseDI CCNNGG 1 cut(s) 371
BseGI GGATG 1 cut(s) 706
BseMII CTCAG 2 cut(s) 138, 176
BseNI ACTGG 1 cut(s) 342
BseXI GCAGC 1 cut(s) 141
BshFI GGCC 1 cut(s) 211
BshTI ACCGGT 1 cut(s) 181
BsiSI CCGG 1 cut(s) 182
BsmAI GTCTC 1 cut(s) 369
BsmI GAATGC 3 cut(s) 157, 574, 717
BsnI GGCC 1 cut(s) 211
Bsp143I GATC 2 cut(s) 555, 650
BspACI CCGC 2 cut(s) 407, 424
BspANI GGCC 1 cut(s) 211
BspCNI CTCAG 2 cut(s) 139, 175
BsrFI RCCGGY 1 cut(s) 181
BsrI ACTGG 1 cut(s) 342
BssAI RCCGGY 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 371
BssMI GATC 2 cut(s) 555, 650
BssSI CACGAG 1 cut(s) 474
BssT1I CCWWGG 1 cut(s) 371
Bst2BI CACGAG 1 cut(s) 474
Bst4CI ACNGT 2 cut(s) 138, 463
Bst6I CTCTTC 3 cut(s) 27, 372, 540
BstC8I GCNNGC 1 cut(s) 672
BstDEI CTNAG 3 cut(s) 147, 162, 321
BstF5I GGATG 1 cut(s) 706
BstKTI GATC 2 cut(s) 558, 653
BstMAI GTCTC 1 cut(s) 369
BstMBI GATC 2 cut(s) 555, 650
BstMWI GCNNNNNNNGC 1 cut(s) 163
BstNSI RCATGY 2 cut(s) 364, 674
BstSFI CTRYAG 2 cut(s) 99, 427
BstV1I GCAGC 1 cut(s) 141
BstX2I RGATCY 1 cut(s) 650
BstYI RGATCY 1 cut(s) 650
BsuRI GGCC 1 cut(s) 211
BtsCI GGATG 1 cut(s) 706
BtsIMutI CAGTG 2 cut(s) 84, 468
Cac8I GCNNGC 1 cut(s) 672
Cfr10I RCCGGY 1 cut(s) 181
Cfr13I GGNCC 2 cut(s) 210, 218
CspAI ACCGGT 1 cut(s) 181
CspCI CAANNNNNGTGG 2 cut(s) 590, 625
CviAII CATG 3 cut(s) 361, 632, 671
CviJI RGCY 9 cut(s) 31, 154, 166, 211, 252, 311, 433, 487, 740
CviKI_1 RGCY 9 cut(s) 31, 154, 166, 211, 252, 311, 433, 487, 740
DdeI CTNAG 3 cut(s) 147, 162, 321
DpnI GATC 2 cut(s) 557, 652
DpnII GATC 2 cut(s) 555, 650
Eam1104I CTCTTC 3 cut(s) 27, 372, 540
EarI CTCTTC 3 cut(s) 27, 372, 540
Eco130I CCWWGG 1 cut(s) 371
Eco47I GGWCC 1 cut(s) 218
Eco57I CTGAAG 4 cut(s) 510, 675, 683, 713
EcoRI GAATTC 1 cut(s) 142
EcoT14I CCWWGG 1 cut(s) 371
ErhI CCWWGG 1 cut(s) 371
FaeI CATG 3 cut(s) 364, 635, 674
FatI CATG 3 cut(s) 360, 631, 670
FauNDI CATATG 1 cut(s) 223
FblI GTMKAC 1 cut(s) 95
Fnu4HI GCNGC 2 cut(s) 155, 408
FokI GGATG 1 cut(s) 713
Fsp4HI GCNGC 2 cut(s) 155, 408
FspBI CTAG 2 cut(s) 107, 540
GluI GCNGC 2 cut(s) 155, 408
HaeIII GGCC 1 cut(s) 211
HapII CCGG 1 cut(s) 182
Hin1II CATG 3 cut(s) 364, 635, 674
HincII GTYRAC 1 cut(s) 36
HindII GTYRAC 1 cut(s) 36
HpaII CCGG 1 cut(s) 182
HphI GGTGA 1 cut(s) 590
Hpy166II GTNNAC 3 cut(s) 36, 96, 466
Hpy188I TCNGA 2 cut(s) 148, 655
Hpy188III TCNNGA 4 cut(s) 107, 238, 379, 540
Hpy8I GTNNAC 3 cut(s) 36, 96, 466
HpyAV CCTTC 2 cut(s) 658, 688
HpyCH4III ACNGT 2 cut(s) 138, 463
HpyCH4IV ACGT 1 cut(s) 74
HpyCH4V TGCA 6 cut(s) 157, 227, 272, 586, 715, 728
HpyF10VI GCNNNNNNNGC 1 cut(s) 163
HpyF3I CTNAG 3 cut(s) 147, 162, 321
HpySE526I ACGT 1 cut(s) 74
Hsp92II CATG 3 cut(s) 364, 635, 674
Kzo9I GATC 2 cut(s) 555, 650
LmnI GCTCC 1 cut(s) 667
LpnPI CCDG 5 cut(s) 195, 201, 321, 355, 501
Lsp1109I GCAGC 1 cut(s) 141
LweI GCATC 1 cut(s) 691
MaeI CTAG 2 cut(s) 107, 540
MaeII ACGT 1 cut(s) 74
MaeIII GTNAC 4 cut(s) 70, 184, 316, 549
MalI GATC 2 cut(s) 557, 652
MboI GATC 2 cut(s) 555, 650
MboII GAAGA 6 cut(s) 14, 359, 557, 647, 668, 698
MflI RGATCY 1 cut(s) 650
MluCI AATT 5 cut(s) 142, 230, 419, 719, 731
MnlI CCTC 2 cut(s) 114, 691
MroXI GAANNNNTTC 1 cut(s) 620
MseI TTAA 6 cut(s) 59, 168, 254, 357, 498, 742
MslI CAYNNNNRTG 3 cut(s) 359, 603, 636
MspI CCGG 1 cut(s) 182
Mva1269I GAATGC 3 cut(s) 157, 574, 717
MwoI GCNNNNNNNGC 1 cut(s) 163
NdeI CATATG 1 cut(s) 223
NdeII GATC 2 cut(s) 555, 650
NlaIII CATG 3 cut(s) 364, 635, 674
NmuCI GTSAC 2 cut(s) 184, 316
NspI RCATGY 2 cut(s) 364, 674
PaeI GCATGC 1 cut(s) 674
PciI ACATGT 1 cut(s) 360
PctI GAATGC 3 cut(s) 157, 574, 717
PdmI GAANNNNTTC 1 cut(s) 620
PinAI ACCGGT 1 cut(s) 181
PkrI GCNGC 2 cut(s) 156, 409
PscI ACATGT 1 cut(s) 360
PspPI GGNCC 2 cut(s) 210, 218
PsuI RGATCY 1 cut(s) 650
RseI CAYNNNNRTG 3 cut(s) 359, 603, 636
SaqAI TTAA 6 cut(s) 59, 168, 254, 357, 498, 742
SatI GCNGC 2 cut(s) 155, 408
Sau3AI GATC 2 cut(s) 555, 650
Sau96I GGNCC 2 cut(s) 210, 218
SfaNI GCATC 1 cut(s) 691
SfcI CTRYAG 2 cut(s) 99, 427
SinI GGWCC 1 cut(s) 218
SmiMI CAYNNNNRTG 3 cut(s) 359, 603, 636
SmlI CTYRAG 1 cut(s) 504
SmoI CTYRAG 1 cut(s) 504
SphI GCATGC 1 cut(s) 674
Sse9I AATT 5 cut(s) 142, 230, 419, 719, 731
SsiI CCGC 2 cut(s) 407, 424
SspI AATATT 2 cut(s) 85, 681
SspMI CTAG 2 cut(s) 107, 540
StyI CCWWGG 1 cut(s) 371
TaaI ACNGT 2 cut(s) 138, 463
TaiI ACGT 1 cut(s) 77
TaqI TCGA 2 cut(s) 351, 614
TasI AATT 5 cut(s) 142, 230, 419, 719, 731
TauI GCSGC 1 cut(s) 410
Tru1I TTAA 6 cut(s) 59, 168, 254, 357, 498, 742
Tru9I TTAA 6 cut(s) 59, 168, 254, 357, 498, 742
TscAI CASTG 2 cut(s) 84, 468
TseFI GTSAC 2 cut(s) 184, 316
TseI GCWGC 1 cut(s) 154
Tsp45I GTSAC 2 cut(s) 184, 316
TspDTI ATGAA 4 cut(s) 219, 293, 613, 648
TspRI CASTG 2 cut(s) 84, 468
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 3 cut(s) 142, 419, 731
XbaI TCTAGA 2 cut(s) 106, 539
XceI RCATGY 2 cut(s) 364, 674
XmiI GTMKAC 1 cut(s) 95
XmnI GAANNNNTTC 1 cut(s) 620
XspI CTAG 2 cut(s) 107, 540
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.