Rmu_sc0003275.1_g000066

Conserved gene of

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003275.1
OG0000224
Physical Location & Seq
Forward (+)
234491 .. 236668
2178 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003275.1_g000066.1.cds

Sequence Viewer

Length: 618 bp
atgcgccgttccaatgtgtctaacatccaaaagcctactactggtaatgcaccaagtaaacgctctcgtgtgcaaagtaccgatcagccatgcccaaatggatcccattctacttcaggtagtgcaatgagtaaacgctctcgtgtgcaaactactgatcagccatgcgaaaattctgtagaagatggactcaattctgctattggcccatatgctgaaatgttggccaatgaaattggtttcatagttcgaaaccatgccccactaaatgtggaaaaatggaagaagattccgaaaattgaagtggataagttggttaaaagaataacggatgaaatgattaagatgcgaactgagacaactcaacctgatggaactcggacaatgacagatgatgaaatttgtgcagaagtcctcggagtcaaatcaggctacatcacgggttctggttttggccctagacctccaccatcaagagtctctcattcgtcgataaatgaaatgtctgaaaagaacaaagtgttgcaagaacaacttcaagagacccaacaccttgtaggggctcaacaacaaaagattgatgtacaaaatgaggtgatccaaaaattggaggagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transposase_24

Protein Analysis

205

Amino Acids

22.73

Weight (kDa)

7.72

Isoelectric Point (pI)

55.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 607
AclWI GGATC 3 cut(s) 96, 109, 592
AcoI YGGCCR 1 cut(s) 225
AcsI RAATTY 2 cut(s) 172, 399
AcuI CTGAAG 1 cut(s) 99
AfaI GTAC 2 cut(s) 79, 585
AfiI CCNNNNNNNGG 3 cut(s) 41, 559, 607
AgsI TTSAA 2 cut(s) 302, 539
Alw26I GTCTC 3 cut(s) 350, 484, 536
AlwI GGATC 3 cut(s) 96, 109, 592
AoxI GGCC 3 cut(s) 205, 225, 454
ApoI RAATTY 2 cut(s) 172, 399
Asp700I GAANNNNTTC 1 cut(s) 534
AspLEI GCGC 1 cut(s) 6
AspS9I GGNCC 2 cut(s) 206, 455
AsuHPI GGTGA 1 cut(s) 607
AsuII TTCGAA 1 cut(s) 250
BalI TGGCCA 1 cut(s) 227
BamHI GGATCC 1 cut(s) 101
BanII GRGCYC 1 cut(s) 565
BauI CACGAG 2 cut(s) 66, 141
BccI CCATC 3 cut(s) 179, 365, 478
BclI TGATCA 1 cut(s) 157
BcoDI GTCTC 3 cut(s) 350, 484, 536
BfaI CTAG 1 cut(s) 459
BfmI CTRYAG 1 cut(s) 177
BmgT120I GGNCC 2 cut(s) 206, 455
BmiI GGNNCC 1 cut(s) 103
BmsI GCATC 1 cut(s) 336
Bpu14I TTCGAA 1 cut(s) 250
BsaI GGTCTC 1 cut(s) 536
BsaJI CCNNGG 1 cut(s) 415
Bsc4I CCNNNNNNNGG 3 cut(s) 41, 559, 607
Bse1I ACTGG 1 cut(s) 46
Bse3DI GCAATG 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 415
BseGI GGATG 2 cut(s) 24, 337
BseLI CCNNNNNNNGG 3 cut(s) 41, 559, 607
BseMI GCAATG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 345
BseNI ACTGG 1 cut(s) 46
BsgI GTGCAG 1 cut(s) 426
BshFI GGCC 3 cut(s) 207, 227, 456
BslI CCNNNNNNNGG 3 cut(s) 41, 559, 607
BsmAI GTCTC 3 cut(s) 350, 484, 536
BsnI GGCC 3 cut(s) 207, 227, 456
Bso31I GGTCTC 1 cut(s) 536
Bsp119I TTCGAA 1 cut(s) 250
Bsp1286I GDGCHC 1 cut(s) 565
Bsp1407I TGTACA 1 cut(s) 583
Bsp143I GATC 4 cut(s) 82, 101, 157, 597
BspANI GGCC 3 cut(s) 207, 227, 456
BspCNI CTCAG 1 cut(s) 346
BspLI GGNNCC 1 cut(s) 103
BspPI GGATC 3 cut(s) 96, 109, 592
BspT104I TTCGAA 1 cut(s) 250
BspTNI GGTCTC 1 cut(s) 536
BsrDI GCAATG 1 cut(s) 132
BsrGI TGTACA 1 cut(s) 583
BsrI ACTGG 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 415
BssMI GATC 4 cut(s) 82, 101, 157, 597
BssSI CACGAG 2 cut(s) 66, 141
Bst2BI CACGAG 2 cut(s) 66, 141
BstAUI TGTACA 1 cut(s) 583
BstBI TTCGAA 1 cut(s) 250
BstDEI CTNAG 1 cut(s) 354
BstF5I GGATG 2 cut(s) 24, 337
BstHHI GCGC 1 cut(s) 6
BstKTI GATC 4 cut(s) 85, 104, 160, 600
BstMAI GTCTC 3 cut(s) 350, 484, 536
BstMBI GATC 4 cut(s) 82, 101, 157, 597
BstSFI CTRYAG 1 cut(s) 177
BstX2I RGATCY 1 cut(s) 101
BstYI RGATCY 1 cut(s) 101
BsuRI GGCC 3 cut(s) 207, 227, 456
BtsCI GGATG 2 cut(s) 24, 337
CfoI GCGC 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 206, 455
Csp6I GTAC 2 cut(s) 78, 584
CviAII CATG 3 cut(s) 90, 165, 257
CviJI RGCY 8 cut(s) 34, 88, 163, 207, 227, 432, 456, 563
CviKI_1 RGCY 8 cut(s) 34, 88, 163, 207, 227, 432, 456, 563
CviQI GTAC 2 cut(s) 78, 584
DdeI CTNAG 1 cut(s) 354
DpnI GATC 4 cut(s) 84, 103, 159, 599
DpnII GATC 4 cut(s) 82, 101, 157, 597
EaeI YGGCCR 1 cut(s) 225
Eco24I GRGCYC 1 cut(s) 565
Eco31I GGTCTC 1 cut(s) 536
Eco57I CTGAAG 1 cut(s) 99
EcoT38I GRGCYC 1 cut(s) 565
FaeI CATG 3 cut(s) 93, 168, 260
FaiI YATR 6 cut(s) 91, 166, 211, 213, 245, 258
FalI AAGNNNNNCTT 2 cut(s) 519, 551
FatI CATG 3 cut(s) 89, 164, 256
FauNDI CATATG 1 cut(s) 211
FbaI TGATCA 1 cut(s) 157
FokI GGATG 2 cut(s) 11, 344
FriOI GRGCYC 1 cut(s) 565
FspBI CTAG 1 cut(s) 459
GlaI GCGC 1 cut(s) 5
HaeIII GGCC 3 cut(s) 207, 227, 456
HhaI GCGC 1 cut(s) 6
Hin1II CATG 3 cut(s) 93, 168, 260
Hin6I GCGC 1 cut(s) 4
HinP1I GCGC 1 cut(s) 4
HinfI GANTC 4 cut(s) 189, 289, 420, 477
HphI GGTGA 1 cut(s) 607
Hpy166II GTNNAC 2 cut(s) 59, 134
Hpy188I TCNGA 4 cut(s) 294, 381, 419, 508
Hpy188III TCNNGA 2 cut(s) 474, 539
Hpy8I GTNNAC 2 cut(s) 59, 134
Hpy99I CGWCG 1 cut(s) 493
HpyCH4V TGCA 6 cut(s) 50, 73, 125, 148, 407, 526
HpyF3I CTNAG 1 cut(s) 354
Hsp92II CATG 3 cut(s) 93, 168, 260
HspAI GCGC 1 cut(s) 4
Ksp22I TGATCA 1 cut(s) 157
Kzo9I GATC 4 cut(s) 82, 101, 157, 597
LpnPI CCDG 5 cut(s) 27, 102, 381, 414, 432
LweI GCATC 1 cut(s) 336
MaeI CTAG 1 cut(s) 459
MalI GATC 4 cut(s) 84, 103, 159, 599
MboI GATC 4 cut(s) 82, 101, 157, 597
MboII GAAGA 3 cut(s) 194, 295, 298
MflI RGATCY 1 cut(s) 101
MhlI GDGCHC 1 cut(s) 565
MlsI TGGCCA 1 cut(s) 227
MluCI AATT 6 cut(s) 172, 193, 234, 297, 399, 605
MluNI TGGCCA 1 cut(s) 227
MlyI GAGTC 3 cut(s) 183, 429, 486
MnlI CCTC 4 cut(s) 425, 474, 586, 604
Mox20I TGGCCA 1 cut(s) 227
MroXI GAANNNNTTC 1 cut(s) 534
MscI TGGCCA 1 cut(s) 227
MseI TTAA 2 cut(s) 318, 342
Msp20I TGGCCA 1 cut(s) 227
NdeI CATATG 1 cut(s) 211
NdeII GATC 4 cut(s) 82, 101, 157, 597
NlaIII CATG 3 cut(s) 93, 168, 260
NlaIV GGNNCC 1 cut(s) 103
NspV TTCGAA 1 cut(s) 250
PdmI GAANNNNTTC 1 cut(s) 534
PfeI GAWTC 1 cut(s) 289
PflMI CCANNNNNTGG 1 cut(s) 607
PleI GAGTC 3 cut(s) 183, 428, 485
PpsI GAGTC 3 cut(s) 183, 428, 485
PspN4I GGNNCC 1 cut(s) 103
PspPI GGNCC 2 cut(s) 206, 455
PsuI RGATCY 1 cut(s) 101
RsaI GTAC 2 cut(s) 79, 585
RsaNI GTAC 2 cut(s) 78, 584
SaqAI TTAA 2 cut(s) 318, 342
Sau3AI GATC 4 cut(s) 82, 101, 157, 597
Sau96I GGNCC 2 cut(s) 206, 455
SchI GAGTC 3 cut(s) 183, 429, 486
SduI GDGCHC 1 cut(s) 565
SetI ASST 5 cut(s) 121, 370, 466, 555, 597
SfaNI GCATC 1 cut(s) 336
SfcI CTRYAG 1 cut(s) 177
SfuI TTCGAA 1 cut(s) 250
Sse9I AATT 6 cut(s) 172, 193, 234, 297, 399, 605
SspMI CTAG 1 cut(s) 459
TaqI TCGA 2 cut(s) 250, 491
TasI AATT 6 cut(s) 172, 193, 234, 297, 399, 605
TatI WGTACW 1 cut(s) 583
TfiI GAWTC 1 cut(s) 289
Tru1I TTAA 2 cut(s) 318, 342
Tru9I TTAA 2 cut(s) 318, 342
TspDTI ATGAA 5 cut(s) 232, 246, 348, 411, 513
TspGWI ACGGA 1 cut(s) 344
Van91I CCANNNNNTGG 1 cut(s) 607
XapI RAATTY 2 cut(s) 172, 399
XmnI GAANNNNTTC 1 cut(s) 534
XspI CTAG 1 cut(s) 459
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.