MD05G1260800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0000441
Physical Location & Seq
Forward (+)
39602006 .. 39603080
1075 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1260800.v1.1.491

Sequence Viewer

Length: 132 bp
ATGAAAGCTATAAATTTTCTCCCAGTATATGATGGAAACAAAATAGGCGATTATCTGGTTCGGGTTTCCTATTATACCTGGAGAACAGTGTTCGTTACCTGGATAACAGTTATGACTGTGGAGCTACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

5.12

Weight (kDa)

8.1

Isoelectric Point (pI)

11.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000441)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g25221 FvH4_2g35252 FvH4_5g07921 FvH4_5g28462
malus_domestica MD05G1260800.v1.1 MD07G1009100.v1.1 MD15G1218700.v1.1
pyrus_communis pycom06g12090 pycom06g12100 pycom13g29410 pycom14g00750 pycom14g00760 pycom17g09320
rosa_chinensis RchiOBHm_Chr1g0331351 RchiOBHm_Chr5g0012151 RchiOBHm_Chr5g0033751 RchiOBHm_Chr5g0050991 RchiOBHm_Chr6g0253451
rosa_laevigata RLG00000003481 RLG00000004801 RLG00000006482 RLG00000007938 RLG00000008591 RLG00000015997 RLG00000016551 RLG00000019935 RLG00000023215 RLG00000023450 RLG00000026296 RLG00000029174 RLG00000030924 RLG00000032897 RLG00000036108
rosa_multiflora Rmu_sc0000611.1_g000017 Rmu_sc0001084.1_g000012 Rmu_sc0001296.1_g000006 Rmu_sc0001306.1_g000031 Rmu_sc0001473.1_g000034 Rmu_sc0002806.1_g000024 Rmu_sc0004605.1_g000010 Rmu_sc0013864.1_g000011
rosa_roxburghii Rroxscaffold_7G00210800
rosa_rugosa Rorug05G0253300
rosa_samantha Rh1AG193700 Rh1BG004100 Rh1BG004200 Rh1DG121500 Rh2AG369300 Rh4BG319300 Rh4BG319400 Rh4CG334700 Rh4CG334800 Rh4DG097100 Rh4DG097200 Rh5AG009200 Rh5AG183100 Rh5BG347200 Rh5CG010100 Rh5CG074900 Rh5CG075000 Rh5CG103300 Rh5CG263100 Rh5CG263300 Rh5DG061600 Rh5DG061700 Rh5DG250100 Rh5DG250200 Rh5DG360300 Rh5DG481800 Rh6BG120200 Rh6CG118200 Rh6CG118300 Rh6CG118400 Rh6CG257400 Rh6DG106600 Rh6DG106700 Rh6DG106800 Rh7AG076400 Rh7AG368300 Rh7AG501100 Rh7BG428100 Rh7BG443600 Rh7BG472400 Rh7CG386600 Rh7CG386700 Rh7DG258200
rosa_wichuraiana Rw0G020150 Rw2G018580 Rw3G027670 Rw4G017220 Rw5G012220 Rw5G016600 Rw7G006450 Rw7G017450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 13
AjnI CCWGG 2 cut(s) 77, 98
AluBI AGCT 2 cut(s) 8, 124
AluI AGCT 2 cut(s) 8, 124
ApoI RAATTY 1 cut(s) 13
BccI CCATC 1 cut(s) 26
BciT130I CCWGG 2 cut(s) 79, 100
Bme1390I CCNGG 2 cut(s) 79, 100
BmrFI CCNGG 2 cut(s) 79, 100
BmrI ACTGGG 1 cut(s) 17
BmuI ACTGGG 1 cut(s) 17
BpmI CTGGAG 1 cut(s) 100
BsaXI ACNNNNNCTCC 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 23
BseBI CCWGG 2 cut(s) 79, 100
BseNI ACTGG 1 cut(s) 23
BsrI ACTGG 1 cut(s) 23
Bst2UI CCWGG 2 cut(s) 79, 100
Bst4CI ACNGT 4 cut(s) 88, 109, 118, 129
BstNI CCWGG 2 cut(s) 79, 100
BstSCI CCNGG 2 cut(s) 77, 98
BtsIMutI CAGTG 1 cut(s) 93
CviJI RGCY 2 cut(s) 8, 124
CviKI_1 RGCY 2 cut(s) 8, 124
EcoRII CCWGG 2 cut(s) 77, 98
FaiI YATR 5 cut(s) 11, 28, 30, 75, 113
GsuI CTGGAG 1 cut(s) 100
HpyCH4III ACNGT 4 cut(s) 88, 109, 118, 129
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 6 cut(s) 36, 41, 64, 85, 91, 112
MaeIII GTNAC 1 cut(s) 94
MluCI AATT 1 cut(s) 13
MspR9I CCNGG 2 cut(s) 79, 100
MvaI CCWGG 2 cut(s) 79, 100
Psp6I CCWGG 2 cut(s) 77, 98
PspGI CCWGG 2 cut(s) 77, 98
ScrFI CCNGG 2 cut(s) 79, 100
SetI ASST 4 cut(s) 10, 80, 101, 126
SgeI CNNG 7 cut(s) 35, 68, 74, 90, 91, 111, 112
Sse9I AATT 1 cut(s) 13
StyD4I CCNGG 2 cut(s) 77, 98
TaaI ACNGT 4 cut(s) 88, 109, 118, 129
TasI AATT 1 cut(s) 13
TscAI CASTG 1 cut(s) 93
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 93
XapI RAATTY 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.