Rmu_sc0013864.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013864.1
OG0000441
Physical Location & Seq
Reverse (-)
36121 .. 37154
1034 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013864.1_g000011.1.cds

Sequence Viewer

Length: 720 bp
atgagaggaagggaacaaatggaaccgaaaattgtgaaatggaatttgctggaacattatgctaggatgaaagcggtctctattcttgagatagaggtaaaggagagagatgaggatcagagtactaatgttgtgcctagtggtgagaagcatttagttgaaattgggactacaagcggtacaaaatcaagagaacaaaaaaatgtgactgattttgatcccaacaagatgttccagctgttaccgacccaattctacttggaagaaagccaagagggaccttcaagcaatgagaatgatatacctgaattggagaaaagggttcaagagtttgctgatttgctggaggttgagcgagccaaaaatgagactcttagtgcagaaaatttgaaactgtgcatggagataggattgctcaggcaagccattcctaaatatgagattccaaatgggaattcaaggaagttgaggacaaaagaactatgtaaaaaaccatcattccttgaaggttatatcattggcgacattagagccaaaagaggtaaggaaaagatcattgatgaaataggtgatgttgttgtggaagaaccagctgtgaagaaggagaagaaacagattgttgtgcaacaaataggtgtgagaaggttaagggttggaaagtgtatgtcccaggtaaatgcagaaaagctcaaggaatatttgtccaaagctagcaggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

239

Amino Acids

27.47

Weight (kDa)

8.27

Isoelectric Point (pI)

48.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000441)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g25221 FvH4_2g35252 FvH4_5g07921 FvH4_5g28462
malus_domestica MD05G1260800.v1.1 MD07G1009100.v1.1 MD15G1218700.v1.1
pyrus_communis pycom06g12090 pycom06g12100 pycom13g29410 pycom14g00750 pycom14g00760 pycom17g09320
rosa_chinensis RchiOBHm_Chr1g0331351 RchiOBHm_Chr5g0012151 RchiOBHm_Chr5g0033751 RchiOBHm_Chr5g0050991 RchiOBHm_Chr6g0253451
rosa_laevigata RLG00000003481 RLG00000004801 RLG00000006482 RLG00000007938 RLG00000008591 RLG00000015997 RLG00000016551 RLG00000019935 RLG00000023215 RLG00000023450 RLG00000026296 RLG00000029174 RLG00000030924 RLG00000032897 RLG00000036108
rosa_multiflora Rmu_sc0000611.1_g000017 Rmu_sc0001084.1_g000012 Rmu_sc0001296.1_g000006 Rmu_sc0001306.1_g000031 Rmu_sc0001473.1_g000034 Rmu_sc0002806.1_g000024 Rmu_sc0004605.1_g000010 Rmu_sc0013864.1_g000011
rosa_roxburghii Rroxscaffold_7G00210800
rosa_rugosa Rorug05G0253300
rosa_samantha Rh1AG193700 Rh1BG004100 Rh1BG004200 Rh1DG121500 Rh2AG369300 Rh4BG319300 Rh4BG319400 Rh4CG334700 Rh4CG334800 Rh4DG097100 Rh4DG097200 Rh5AG009200 Rh5AG183100 Rh5BG347200 Rh5CG010100 Rh5CG074900 Rh5CG075000 Rh5CG103300 Rh5CG263100 Rh5CG263300 Rh5DG061600 Rh5DG061700 Rh5DG250100 Rh5DG250200 Rh5DG360300 Rh5DG481800 Rh6BG120200 Rh6CG118200 Rh6CG118300 Rh6CG118400 Rh6CG257400 Rh6DG106600 Rh6DG106700 Rh6DG106800 Rh7AG076400 Rh7AG368300 Rh7AG501100 Rh7BG428100 Rh7BG443600 Rh7BG472400 Rh7CG386600 Rh7CG386700 Rh7DG258200
rosa_wichuraiana Rw0G020150 Rw2G018580 Rw3G027670 Rw4G017220 Rw5G012220 Rw5G016600 Rw7G006450 Rw7G017450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 705
AciI CCGC 2 cut(s) 74, 177
AclWI GGATC 2 cut(s) 123, 212
AcsI RAATTY 3 cut(s) 43, 385, 454
AfaI GTAC 2 cut(s) 124, 181
AgsI TTSAA 6 cut(s) 161, 285, 326, 391, 459, 506
AjnI CCWGG 1 cut(s) 669
AjuI GAANNNNNNNTTGG 4 cut(s) 215, 247, 439, 471
AluBI AGCT 4 cut(s) 238, 593, 688, 710
AluI AGCT 4 cut(s) 238, 593, 688, 710
Alw26I GTCTC 2 cut(s) 82, 362
AlwI GGATC 2 cut(s) 123, 212
ApoI RAATTY 3 cut(s) 43, 385, 454
AspS9I GGNCC 1 cut(s) 278
AsuHPI GGTGA 2 cut(s) 155, 581
AsuNHI GCTAGC 1 cut(s) 710
AvaII GGWCC 1 cut(s) 278
BccI CCATC 1 cut(s) 502
BciT130I CCWGG 1 cut(s) 671
BcoDI GTCTC 2 cut(s) 82, 362
BfaI CTAG 3 cut(s) 63, 138, 711
BfuAI ACCTGC 1 cut(s) 705
BmcAI AGTACT 1 cut(s) 124
Bme1390I CCNGG 1 cut(s) 671
Bme18I GGWCC 1 cut(s) 278
BmgT120I GGNCC 1 cut(s) 278
BmiI GGNNCC 2 cut(s) 24, 279
BmrFI CCNGG 1 cut(s) 671
BmtI GCTAGC 1 cut(s) 714
BpmI CTGGAG 1 cut(s) 365
Bpu10I CCTNAGC 1 cut(s) 416
BpuEI CTTGAG 2 cut(s) 107, 674
BsaBI GATNNNNATC 2 cut(s) 114, 216
BsaI GGTCTC 1 cut(s) 82
BsaJI CCNNGG 1 cut(s) 669
Bse3DI GCAATG 1 cut(s) 295
Bse8I GATNNNNATC 2 cut(s) 114, 216
BseBI CCWGG 1 cut(s) 671
BseDI CCNNGG 1 cut(s) 669
BseGI GGATG 1 cut(s) 72
BseJI GATNNNNATC 2 cut(s) 114, 216
BseMI GCAATG 1 cut(s) 295
BseMII CTCAG 1 cut(s) 430
BsgI GTGCAG 1 cut(s) 399
BslFI GGGAC 3 cut(s) 181, 291, 652
BsmAI GTCTC 2 cut(s) 82, 362
BsmFI GGGAC 3 cut(s) 181, 291, 652
Bso31I GGTCTC 1 cut(s) 82
Bsp143I GATC 3 cut(s) 115, 217, 552
BspACI CCGC 2 cut(s) 74, 177
BspCNI CTCAG 1 cut(s) 429
BspLI GGNNCC 2 cut(s) 24, 279
BspMI ACCTGC 1 cut(s) 705
BspOI GCTAGC 1 cut(s) 714
BspPI GGATC 2 cut(s) 123, 212
BspTNI GGTCTC 1 cut(s) 82
BsrDI GCAATG 1 cut(s) 295
BssECI CCNNGG 1 cut(s) 669
BssMI GATC 3 cut(s) 115, 217, 552
Bst2UI CCWGG 1 cut(s) 671
Bst4CI ACNGT 1 cut(s) 396
BstC8I GCNNGC 3 cut(s) 357, 423, 712
BstDEI CTNAG 2 cut(s) 374, 416
BstF5I GGATG 1 cut(s) 72
BstKTI GATC 3 cut(s) 118, 220, 555
BstMAI GTCTC 2 cut(s) 82, 362
BstMBI GATC 3 cut(s) 115, 217, 552
BstNI CCWGG 1 cut(s) 671
BstSCI CCNGG 1 cut(s) 669
BtsCI GGATG 1 cut(s) 72
BveI ACCTGC 1 cut(s) 705
Cac8I GCNNGC 3 cut(s) 357, 423, 712
Cfr13I GGNCC 1 cut(s) 278
Csp6I GTAC 2 cut(s) 123, 180
CviAII CATG 1 cut(s) 400
CviJI RGCY 8 cut(s) 238, 270, 359, 425, 533, 593, 688, 710
CviKI_1 RGCY 8 cut(s) 238, 270, 359, 425, 533, 593, 688, 710
CviQI GTAC 2 cut(s) 123, 180
DdeI CTNAG 2 cut(s) 374, 416
DpnI GATC 3 cut(s) 117, 219, 554
DpnII GATC 3 cut(s) 115, 217, 552
Eco31I GGTCTC 1 cut(s) 82
Eco47I GGWCC 1 cut(s) 278
EcoO109I RGGNCCY 1 cut(s) 278
EcoRI GAATTC 1 cut(s) 454
EcoRII CCWGG 1 cut(s) 669
FaeI CATG 1 cut(s) 403
FaiI YATR 7 cut(s) 60, 302, 401, 438, 484, 513, 665
FaqI GGGAC 3 cut(s) 181, 291, 652
FatI CATG 1 cut(s) 399
FokI GGATG 1 cut(s) 79
FspBI CTAG 3 cut(s) 63, 138, 711
GsuI CTGGAG 1 cut(s) 365
Hin1II CATG 1 cut(s) 403
HinfI GANTC 2 cut(s) 370, 442
HphI GGTGA 2 cut(s) 155, 581
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 3 cut(s) 86, 189, 326
HpyAV CCTTC 5 cut(s) 3, 291, 500, 595, 636
HpyCH4III ACNGT 1 cut(s) 396
HpyCH4V TGCA 4 cut(s) 380, 399, 625, 680
HpyF3I CTNAG 2 cut(s) 374, 416
Hsp92II CATG 1 cut(s) 403
Kzo9I GATC 3 cut(s) 115, 217, 552
LpnPI CCDG 9 cut(s) 35, 248, 318, 329, 403, 603, 656, 683, 700
MaeI CTAG 3 cut(s) 63, 138, 711
MaeIII GTNAC 2 cut(s) 205, 240
MalI GATC 3 cut(s) 117, 219, 554
MboI GATC 3 cut(s) 115, 217, 552
MboII GAAGA 4 cut(s) 275, 596, 610, 619
MluCI AATT 7 cut(s) 30, 43, 162, 251, 308, 385, 454
MlyI GAGTC 1 cut(s) 364
MmeI TCCRAC 1 cut(s) 634
MnlI CCTC 6 cut(s) 88, 106, 268, 340, 462, 533
MseI TTAA 1 cut(s) 647
MspA1I CMGCKG 2 cut(s) 238, 593
MspR9I CCNGG 1 cut(s) 671
MvaI CCWGG 1 cut(s) 671
NdeII GATC 3 cut(s) 115, 217, 552
NheI GCTAGC 1 cut(s) 710
NlaIII CATG 1 cut(s) 403
NlaIV GGNNCC 2 cut(s) 24, 279
NmuCI GTSAC 1 cut(s) 205
PfeI GAWTC 1 cut(s) 442
PleI GAGTC 1 cut(s) 364
PpsI GAGTC 1 cut(s) 364
PpuMI RGGWCCY 1 cut(s) 278
Psp5II RGGWCCY 1 cut(s) 278
Psp6I CCWGG 1 cut(s) 669
PspGI CCWGG 1 cut(s) 669
PspN4I GGNNCC 2 cut(s) 24, 279
PspPI GGNCC 1 cut(s) 278
PspPPI RGGWCCY 1 cut(s) 278
PvuII CAGCTG 2 cut(s) 238, 593
RsaI GTAC 2 cut(s) 124, 181
RsaNI GTAC 2 cut(s) 123, 180
SaqAI TTAA 1 cut(s) 647
Sau3AI GATC 3 cut(s) 115, 217, 552
Sau96I GGNCC 1 cut(s) 278
ScaI AGTACT 1 cut(s) 124
SchI GAGTC 1 cut(s) 364
ScrFI CCNGG 1 cut(s) 671
SinI GGWCC 1 cut(s) 278
SmlI CTYRAG 2 cut(s) 86, 689
SmoI CTYRAG 2 cut(s) 86, 689
Sse9I AATT 7 cut(s) 30, 43, 162, 251, 308, 385, 454
SsiI CCGC 2 cut(s) 74, 177
SspI AATATT 1 cut(s) 698
SspMI CTAG 3 cut(s) 63, 138, 711
StyD4I CCNGG 1 cut(s) 669
TaaI ACNGT 1 cut(s) 396
TasI AATT 7 cut(s) 30, 43, 162, 251, 308, 385, 454
TatI WGTACW 1 cut(s) 122
TfiI GAWTC 1 cut(s) 442
Tru1I TTAA 1 cut(s) 647
Tru9I TTAA 1 cut(s) 647
TseFI GTSAC 1 cut(s) 205
Tsp45I GTSAC 1 cut(s) 205
TspDTI ATGAA 2 cut(s) 83, 576
VpaK11BI GGWCC 1 cut(s) 278
XapI RAATTY 3 cut(s) 43, 385, 454
XspI CTAG 3 cut(s) 63, 138, 711
ZrmI AGTACT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.