Rmu_sc0001306.1_g000031

Plant mobile domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001306.1
OG0000441
Physical Location & Seq
Forward (+)
96353 .. 97192
840 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001306.1_g000031.1.cds

Sequence Viewer

Length: 840 bp
atggcaaagaaggagtatccctatctagagtacaggtgtgatttattgaagtttggacgtttgatgacggatgagcttagagcagacataacacaagagaaactagttttgatccaaagaacaccatttgggagcttgtttatggcgtattacaatggtacattaatagaatctgcttgcaaaaaatctgatttggaaatagtggctctcttgaagtgttttaaccagcaaaacaaaagttttaatttcggggagttcaccggtactataaccagcaaagacatctctgagttgtttggattaacactcattggggaagaaattaacctagatcagaagaagaagaaagaggatgacgggttcaggacaagacaactgggcggagtcccgaggatgagcaaggcaatattagaacaaaaaataaaacatgtagctaagttgagagggattgaggatgaaaaagattttgtaagtcaaaacaaaagttttaagtttggggagttcaccggtactataaccagcaaagacatctctgagttgtttggcttaacactcattggggaagaaattaacctagatcagaagaagaagaaagaggatgacggattcaggacaagacaactgggcggagttccgaggatgagcaaggcaatattagaacaaaaaataaaacatgtagctaagttgagagggattgaggatgaaaaagattttgtaaggcttgtctgtctctacttttgcgttacattattcctctgcaatagtggtaatgaactctgttggaatgtcctcccatatatagaggatattgaaacaatgtcgcagtatgcatgggtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1985 PMD

Protein Analysis

279

Amino Acids

32.11

Weight (kDa)

7.49

Isoelectric Point (pI)

41.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000441)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g25221 FvH4_2g35252 FvH4_5g07921 FvH4_5g28462
malus_domestica MD05G1260800.v1.1 MD07G1009100.v1.1 MD15G1218700.v1.1
pyrus_communis pycom06g12090 pycom06g12100 pycom13g29410 pycom14g00750 pycom14g00760 pycom17g09320
rosa_chinensis RchiOBHm_Chr1g0331351 RchiOBHm_Chr5g0012151 RchiOBHm_Chr5g0033751 RchiOBHm_Chr5g0050991 RchiOBHm_Chr6g0253451
rosa_laevigata RLG00000003481 RLG00000004801 RLG00000006482 RLG00000007938 RLG00000008591 RLG00000015997 RLG00000016551 RLG00000019935 RLG00000023215 RLG00000023450 RLG00000026296 RLG00000029174 RLG00000030924 RLG00000032897 RLG00000036108
rosa_multiflora Rmu_sc0000611.1_g000017 Rmu_sc0001084.1_g000012 Rmu_sc0001296.1_g000006 Rmu_sc0001306.1_g000031 Rmu_sc0001473.1_g000034 Rmu_sc0002806.1_g000024 Rmu_sc0004605.1_g000010 Rmu_sc0013864.1_g000011
rosa_roxburghii Rroxscaffold_7G00210800
rosa_rugosa Rorug05G0253300
rosa_samantha Rh1AG193700 Rh1BG004100 Rh1BG004200 Rh1DG121500 Rh2AG369300 Rh4BG319300 Rh4BG319400 Rh4CG334700 Rh4CG334800 Rh4DG097100 Rh4DG097200 Rh5AG009200 Rh5AG183100 Rh5BG347200 Rh5CG010100 Rh5CG074900 Rh5CG075000 Rh5CG103300 Rh5CG263100 Rh5CG263300 Rh5DG061600 Rh5DG061700 Rh5DG250100 Rh5DG250200 Rh5DG360300 Rh5DG481800 Rh6BG120200 Rh6CG118200 Rh6CG118300 Rh6CG118400 Rh6CG257400 Rh6DG106600 Rh6DG106700 Rh6DG106800 Rh7AG076400 Rh7AG368300 Rh7AG501100 Rh7BG428100 Rh7BG443600 Rh7BG472400 Rh7CG386600 Rh7CG386700 Rh7DG258200
rosa_wichuraiana Rw0G020150 Rw2G018580 Rw3G027670 Rw4G017220 Rw5G012220 Rw5G016600 Rw7G006450 Rw7G017450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 381, 627
AclWI GGATC 1 cut(s) 106
AfaI GTAC 4 cut(s) 32, 160, 265, 511
AflIII ACRYGT 2 cut(s) 427, 673
AgeI ACCGGT 2 cut(s) 260, 506
AgsI TTSAA 3 cut(s) 49, 214, 812
AhlI ACTAGT 1 cut(s) 103
AloI GAACNNNNNNTCC 2 cut(s) 344, 376
AluBI AGCT 4 cut(s) 76, 135, 434, 680
AluI AGCT 4 cut(s) 76, 135, 434, 680
Alw26I GTCTC 1 cut(s) 734
AlwI GGATC 1 cut(s) 106
Ama87I CYCGRG 1 cut(s) 388
AseI ATTAAT 1 cut(s) 164
AsiGI ACCGGT 2 cut(s) 260, 506
AsuHPI GGTGA 2 cut(s) 250, 496
AvaI CYCGRG 1 cut(s) 388
BciVI GTATCC 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 734
BcuI ACTAGT 1 cut(s) 103
BfaI CTAG 4 cut(s) 26, 104, 329, 575
BfuI GTATCC 1 cut(s) 27
BmeT110I CYCGRG 1 cut(s) 388
BmrI ACTGGG 2 cut(s) 386, 632
BmuI ACTGGG 2 cut(s) 386, 632
BsaJI CCNNGG 2 cut(s) 389, 635
BsaWI WCCGGW 2 cut(s) 260, 506
Bse118I RCCGGY 2 cut(s) 260, 506
Bse1I ACTGG 2 cut(s) 381, 627
BseDI CCNNGG 2 cut(s) 389, 635
BseGI GGATG 7 cut(s) 76, 358, 399, 460, 604, 645, 706
BseMII CTCAG 2 cut(s) 279, 525
BseNI ACTGG 2 cut(s) 381, 627
BshTI ACCGGT 2 cut(s) 260, 506
BsiHKCI CYCGRG 1 cut(s) 388
BsiSI CCGG 2 cut(s) 261, 507
BslFI GGGAC 1 cut(s) 371
BsmAI GTCTC 1 cut(s) 734
BsmFI GGGAC 1 cut(s) 371
BsoBI CYCGRG 1 cut(s) 388
Bsp143I GATC 3 cut(s) 111, 331, 577
BspACI CCGC 2 cut(s) 381, 627
BspCNI CTCAG 2 cut(s) 280, 526
BspPI GGATC 1 cut(s) 106
BsrFI RCCGGY 2 cut(s) 260, 506
BsrI ACTGG 2 cut(s) 381, 627
BssAI RCCGGY 2 cut(s) 260, 506
BssECI CCNNGG 2 cut(s) 389, 635
BssMI GATC 3 cut(s) 111, 331, 577
BstC8I GCNNGC 1 cut(s) 178
BstDEI CTNAG 5 cut(s) 77, 288, 435, 534, 681
BstF5I GGATG 7 cut(s) 76, 358, 399, 460, 604, 645, 706
BstKTI GATC 3 cut(s) 114, 334, 580
BstMAI GTCTC 1 cut(s) 734
BstMBI GATC 3 cut(s) 111, 331, 577
BstNSI RCATGY 2 cut(s) 431, 677
BsuI GTATCC 1 cut(s) 27
BtsCI GGATG 7 cut(s) 76, 358, 399, 460, 604, 645, 706
Cac8I GCNNGC 1 cut(s) 178
Cfr10I RCCGGY 2 cut(s) 260, 506
Csp6I GTAC 4 cut(s) 31, 159, 264, 510
CspAI ACCGGT 2 cut(s) 260, 506
CviAII CATG 3 cut(s) 428, 674, 831
CviJI RGCY 7 cut(s) 76, 135, 206, 434, 546, 680, 721
CviKI_1 RGCY 7 cut(s) 76, 135, 206, 434, 546, 680, 721
CviQI GTAC 4 cut(s) 31, 159, 264, 510
DdeI CTNAG 5 cut(s) 77, 288, 435, 534, 681
DpnI GATC 3 cut(s) 113, 333, 579
DpnII GATC 3 cut(s) 111, 331, 577
EciI GGCGGA 2 cut(s) 396, 642
Eco88I CYCGRG 1 cut(s) 388
EcoT22I ATGCAT 1 cut(s) 832
FaeI CATG 3 cut(s) 431, 677, 834
FaqI GGGAC 1 cut(s) 371
FatI CATG 3 cut(s) 427, 673, 830
FokI GGATG 7 cut(s) 83, 365, 406, 467, 611, 652, 713
FspBI CTAG 4 cut(s) 26, 104, 329, 575
HapII CCGG 2 cut(s) 261, 507
Hin1II CATG 3 cut(s) 431, 677, 834
HinfI GANTC 3 cut(s) 170, 384, 606
HpaII CCGG 2 cut(s) 261, 507
HphI GGTGA 2 cut(s) 250, 496
Hpy166II GTNNAC 2 cut(s) 258, 504
Hpy188I TCNGA 6 cut(s) 190, 289, 336, 535, 582, 636
Hpy188III TCNNGA 5 cut(s) 26, 211, 364, 388, 610
Hpy8I GTNNAC 2 cut(s) 258, 504
HpyAV CCTTC 1 cut(s) 4
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 3 cut(s) 180, 759, 830
HpyF3I CTNAG 5 cut(s) 77, 288, 435, 534, 681
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 3 cut(s) 431, 677, 834
Kzo9I GATC 3 cut(s) 111, 331, 577
LmnI GCTCC 1 cut(s) 132
MaeI CTAG 4 cut(s) 26, 104, 329, 575
MaeII ACGT 1 cut(s) 58
MaeIII GTNAC 1 cut(s) 742
MalI GATC 3 cut(s) 113, 333, 579
MboI GATC 3 cut(s) 111, 331, 577
MboII GAAGA 8 cut(s) 329, 349, 352, 355, 575, 595, 598, 601
MluCI AATT 3 cut(s) 244, 321, 567
MlyI GAGTC 1 cut(s) 393
MmeI TCCRAC 1 cut(s) 761
Mph1103I ATGCAT 1 cut(s) 832
MseI TTAA 8 cut(s) 164, 222, 243, 302, 324, 489, 548, 570
MspI CCGG 2 cut(s) 261, 507
NdeII GATC 3 cut(s) 111, 331, 577
NlaIII CATG 3 cut(s) 431, 677, 834
NsiI ATGCAT 1 cut(s) 832
NspI RCATGY 2 cut(s) 431, 677
PciI ACATGT 2 cut(s) 427, 673
PfeI GAWTC 2 cut(s) 170, 606
PinAI ACCGGT 2 cut(s) 260, 506
PleI GAGTC 1 cut(s) 392
PpsI GAGTC 1 cut(s) 392
PscI ACATGT 2 cut(s) 427, 673
PshBI ATTAAT 1 cut(s) 164
RsaI GTAC 4 cut(s) 32, 160, 265, 511
RsaNI GTAC 4 cut(s) 31, 159, 264, 510
SaqAI TTAA 8 cut(s) 164, 222, 243, 302, 324, 489, 548, 570
Sau3AI GATC 3 cut(s) 111, 331, 577
SchI GAGTC 1 cut(s) 393
SetI ASST 8 cut(s) 38, 61, 78, 137, 330, 436, 576, 682
SpeI ACTAGT 1 cut(s) 103
Sse9I AATT 3 cut(s) 244, 321, 567
SsiI CCGC 2 cut(s) 381, 627
SspI AATATT 2 cut(s) 408, 654
SspMI CTAG 4 cut(s) 26, 104, 329, 575
TaiI ACGT 1 cut(s) 61
TasI AATT 3 cut(s) 244, 321, 567
TatI WGTACW 1 cut(s) 30
TfiI GAWTC 2 cut(s) 170, 606
Tru1I TTAA 8 cut(s) 164, 222, 243, 302, 324, 489, 548, 570
Tru9I TTAA 8 cut(s) 164, 222, 243, 302, 324, 489, 548, 570
TspDTI ATGAA 3 cut(s) 471, 717, 786
TspGWI ACGGA 2 cut(s) 83, 618
VspI ATTAAT 1 cut(s) 164
XbaI TCTAGA 1 cut(s) 25
XceI RCATGY 2 cut(s) 431, 677
XspI CTAG 4 cut(s) 26, 104, 329, 575
Zsp2I ATGCAT 1 cut(s) 832
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.