RchiOBHm_Chr5g0009841

Conserved gene of

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
6512889 .. 6516576
3688 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGACAGTTAATGAAATTTGTACAAAAGTCCTTGGAGTCAAATCAGGCTACATCAAGGGTTGTGGTTTTGGCCCTAGATCTCCACCATCAAGGGTCTCTCACTCGTCGATAAATGAAATGTCTGAAAAGAACAAAGAGTTGCAAGAACAGCTTCAAGAGACCCAACACCTTGTAGGGAATCAACAACAAAAAATTGATGCACAAAATGAAGTGATCCAAAGATTGGAGGAGCAAACCAAAAAGTTTGAGGAGTTCATGGCTAACTTTTCCAGGCAACAGCCATCAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.93

Weight (kDa)

6.73

Isoelectric Point (pI)

69.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000224)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08145 FvH4_4g05492 FvH4_4g15892
pyrus_communis pycom07g09690 pycom16g18380
rosa_chinensis RchiOBHm_Chr0c17g0499961 RchiOBHm_Chr1g0345631 RchiOBHm_Chr1g0345641 RchiOBHm_Chr1g0381191 RchiOBHm_Chr2g0102381 RchiOBHm_Chr2g0106131 RchiOBHm_Chr2g0148461 RchiOBHm_Chr2g0148471 RchiOBHm_Chr2g0157121 RchiOBHm_Chr3g0476041 RchiOBHm_Chr3g0476051 RchiOBHm_Chr3g0486961 RchiOBHm_Chr3g0487551 RchiOBHm_Chr4g0385011 RchiOBHm_Chr4g0410891 RchiOBHm_Chr4g0415291 RchiOBHm_Chr4g0427801 RchiOBHm_Chr4g0427811 RchiOBHm_Chr5g0001961 RchiOBHm_Chr5g0009841 RchiOBHm_Chr5g0025231 RchiOBHm_Chr6g0272461 RchiOBHm_Chr7g0199391 RchiOBHm_Chr7g0214031
rosa_laevigata RLG00000000706 RLG00000000749 RLG00000000750 RLG00000001166 RLG00000001748 RLG00000008952 RLG00000009088 RLG00000009090 RLG00000009094 RLG00000015391 RLG00000016519 RLG00000016520 RLG00000017174 RLG00000018887 RLG00000023058 RLG00000023059 RLG00000028282 RLG00000028531 RLG00000030444 RLG00000034592 RLG00000036555
rosa_multiflora Rmu_sc0000045.1_g000015 Rmu_sc0000157.1_g000011 Rmu_sc0000493.1_g000080 Rmu_sc0001307.1_g000027 Rmu_sc0001470.1_g000010 Rmu_sc0002277.1_g000022 Rmu_sc0002365.1_g000027 Rmu_sc0002693.1_g000008 Rmu_sc0002833.1_g000051 Rmu_sc0003275.1_g000066 Rmu_sc0003286.1_g000008 Rmu_sc0004234.1_g000035 Rmu_sc0004546.1_g000001 Rmu_sc0005058.1_g000004 Rmu_sc0007025.1_g000015 Rmu_sc0008144.1_g000006 Rmu_sc0008688.1_g000001 Rmu_sc0009185.1_g000010 Rmu_sc0020638.1_g000001
rosa_roxburghii Rroxscaffold_158G00443750 Rroxscaffold_1G00001770 Rroxscaffold_1G00002620 Rroxscaffold_1G00024490 Rroxscaffold_1G00035180 Rroxscaffold_1G00035190 Rroxscaffold_1G00061370 Rroxscaffold_1G00075590 Rroxscaffold_2G00110960 Rroxscaffold_2G00121340 Rroxscaffold_2G00128850 Rroxscaffold_2G00142580 Rroxscaffold_2G00142590 Rroxscaffold_3G00223630 Rroxscaffold_3G00263220 Rroxscaffold_4G00310820 Rroxscaffold_5G00336270 Rroxscaffold_5G00336280 Rroxscaffold_5G00336320 Rroxscaffold_5G00349820 Rroxscaffold_6G00395720 Rroxscaffold_6G00395910 Rroxscaffold_6G00415660 Rroxscaffold_7G00179770 Rroxscaffold_7G00184390 Rroxscaffold_7G00189270 Rroxscaffold_7G00197240 Rroxscaffold_8G00436850 Rroxscaffold_8G00436860 Rroxscaffold_8G00436880
rosa_rugosa Rorug01G0118400 Rorug02G0048900 Rorug02G0185600 Rorug02G0222600 Rorug03G0152800 Rorug04G0047600 Rorug04G0446400 Rorug05G0118900 Rorug05G0359700 Rorug05G0374800 Rorug05G0374900 Rorug05G0375000 Rorug05G0375100 Rorug05G0418900 Rorug05G0540000 Rorug05G0540000 Rorug05G0540100 Rorug06G0358700 Rorug06G0358700 Rorug06G0408700 Rorug06G0408700 Rorug06G0408800 Rorug06G0408900 Rorug07G0203000
rosa_samantha Rh1CG190700 Rh1CG196300 Rh2BG566600 Rh2CG188900 Rh3AG090900 Rh3AG278200 Rh3BG233900 Rh3CG094300 Rh4BG202100 Rh5BG543100 Rh5CG566000 Rh5DG397500 Rh7CG432800
rosa_wichuraiana Rw0G017850 Rw1G010340 Rw1G016290 Rw2G018520 Rw3G008970 Rw5G028090 Rw5G043930 Rw6G014660 Rw6G030340 Rw7G038240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 223
AclWI GGATC 1 cut(s) 208
AcsI RAATTY 1 cut(s) 15
AfaI GTAC 1 cut(s) 22
AfiI CCNNNNNNNGG 1 cut(s) 223
AgsI TTSAA 1 cut(s) 155
AjnI CCWGG 1 cut(s) 269
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
Alw26I GTCTC 2 cut(s) 100, 152
AlwI GGATC 1 cut(s) 208
AoxI GGCC 1 cut(s) 70
ApoI RAATTY 1 cut(s) 15
Asp700I GAANNNNTTC 1 cut(s) 150
AspS9I GGNCC 1 cut(s) 71
BccI CCATC 2 cut(s) 94, 289
BciT130I CCWGG 1 cut(s) 271
BcoDI GTCTC 2 cut(s) 100, 152
BfaI CTAG 1 cut(s) 75
BglII AGATCT 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 271
BmgT120I GGNCC 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 271
BmsI GCATC 1 cut(s) 187
BsaI GGTCTC 2 cut(s) 100, 152
BsaJI CCNNGG 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 223
BseBI CCWGG 1 cut(s) 271
BseDI CCNNGG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 223
BseRI GAGGAG 2 cut(s) 242, 263
BshFI GGCC 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 223
BsmAI GTCTC 2 cut(s) 100, 152
BsnI GGCC 1 cut(s) 72
Bso31I GGTCTC 2 cut(s) 100, 152
Bsp1407I TGTACA 1 cut(s) 20
Bsp143I GATC 2 cut(s) 77, 213
BspANI GGCC 1 cut(s) 72
BspPI GGATC 1 cut(s) 208
BspTNI GGTCTC 2 cut(s) 100, 152
BsrGI TGTACA 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 31
BssMI GATC 2 cut(s) 77, 213
BssT1I CCWWGG 1 cut(s) 31
Bst2UI CCWGG 1 cut(s) 271
Bst4CI ACNGT 1 cut(s) 7
BstAUI TGTACA 1 cut(s) 20
BstKTI GATC 2 cut(s) 80, 216
BstMAI GTCTC 2 cut(s) 100, 152
BstMBI GATC 2 cut(s) 77, 213
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 271
BstSCI CCNGG 1 cut(s) 269
BstX2I RGATCY 1 cut(s) 77
BstYI RGATCY 1 cut(s) 77
BsuRI GGCC 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 71
Csp6I GTAC 1 cut(s) 21
CspCI CAANNNNNGTGG 2 cut(s) 43, 78
CviAII CATG 1 cut(s) 256
CviJI RGCY 5 cut(s) 48, 72, 151, 260, 280
CviKI_1 RGCY 5 cut(s) 48, 72, 151, 260, 280
CviQI GTAC 1 cut(s) 21
DpnI GATC 2 cut(s) 79, 215
DpnII GATC 2 cut(s) 77, 213
Eco130I CCWWGG 1 cut(s) 31
Eco31I GGTCTC 2 cut(s) 100, 152
EcoRII CCWGG 1 cut(s) 269
EcoT14I CCWWGG 1 cut(s) 31
ErhI CCWWGG 1 cut(s) 31
FaeI CATG 1 cut(s) 259
FaiI YATR 1 cut(s) 257
FalI AAGNNNNNCTT 2 cut(s) 135, 167
FatI CATG 1 cut(s) 255
FspBI CTAG 1 cut(s) 75
HaeIII GGCC 1 cut(s) 72
Hin1II CATG 1 cut(s) 259
HinfI GANTC 2 cut(s) 36, 178
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 155
Hpy99I CGWCG 1 cut(s) 109
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4V TGCA 2 cut(s) 142, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
Hsp92II CATG 1 cut(s) 259
Kzo9I GATC 2 cut(s) 77, 213
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 3 cut(s) 30, 256, 283
LweI GCATC 1 cut(s) 187
MaeI CTAG 1 cut(s) 75
MalI GATC 2 cut(s) 79, 215
MboI GATC 2 cut(s) 77, 213
MflI RGATCY 1 cut(s) 77
MluCI AATT 2 cut(s) 15, 192
MlyI GAGTC 1 cut(s) 45
MnlI CCTC 2 cut(s) 220, 241
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 271
MvaI CCWGG 1 cut(s) 271
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 2 cut(s) 77, 213
NlaIII CATG 1 cut(s) 259
PdmI GAANNNNTTC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 178
PflMI CCANNNNNTGG 1 cut(s) 223
PleI GAGTC 1 cut(s) 44
PpsI GAGTC 1 cut(s) 44
Psp6I CCWGG 1 cut(s) 269
PspGI CCWGG 1 cut(s) 269
PspPI GGNCC 1 cut(s) 71
PsuI RGATCY 1 cut(s) 77
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 2 cut(s) 77, 213
Sau96I GGNCC 1 cut(s) 71
SchI GAGTC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 271
SetI ASST 2 cut(s) 153, 171
SfaNI GCATC 1 cut(s) 187
Sse9I AATT 2 cut(s) 15, 192
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 269
StyI CCWWGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 7
TaqI TCGA 1 cut(s) 107
TasI AATT 2 cut(s) 15, 192
TatI WGTACW 1 cut(s) 20
TfiI GAWTC 1 cut(s) 178
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TspDTI ATGAA 4 cut(s) 27, 129, 222, 244
Van91I CCANNNNNTGG 1 cut(s) 223
XapI RAATTY 1 cut(s) 15
XmnI GAANNNNTTC 1 cut(s) 150
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.