RchiOBHm_Chr4g0431021

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
55367921 .. 55368178
258 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGAAAGGATATGGATCTCTTGAATTGTATAATATGTCTTCTTTTGCTTGGATCACCATCCAAGCCTTGTATTTCCTTGCCAGAAGAAGCAAAGCAATTCCAAGAACTAGGCTTCCACGACCAAAGCCACTTCCATTGATTGGGAATCTGTTTGAGATCGGAGATAAACCCCATCTCTCCCTCACTAAGCTTTCCCAACGCTATGGCCCCATAATGAGTTTGCAACTCGGCCAACTAACCACAATTGTAGTTTCTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.6

Weight (kDa)

10.49

Isoelectric Point (pI)

36.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 39 - 85 2.6e-08 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000168)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G61035 AT3G61035 AT3G61035 AT3G61035
fragaria_vesca FvH4_4g24041 FvH4_4g24050 FvH4_4g24050 FvH4_4g24052 FvH4_4g24053 FvH4_4g24060 FvH4_4g24060 FvH4_4g24070 FvH4_4g24080 FvH4_4g24230 FvH4_4g24640 FvH4_4g27900
malus_domestica MD06G1131200.v1.1 MD07G1012100.v1.1 MD12G1099200.v1.1 MD13G1115700.v1.1 MD13G1116100.v1.1 MD16G1115800.v1.1 MD16G1115900.v1.1 MD16G1116200.v1.1 MD16G1116300.v1.1
prunus_persica Prupe.1G229900_v2.0.a1 Prupe.1G230300_v2.0.a1 Prupe.1G230500_v2.0.a1 Prupe.1G230600_v2.0.a1 Prupe.1G230800_v2.0.a1 Prupe.1G230900_v2.0.a1 Prupe.1G231000_v2.0.a1 Prupe.1G231300_v2.0.a1 Prupe.1G231400_v2.0.a1 Prupe.6G237700_v2.0.a1
pyrus_communis pycom13g09840 pycom13g10020 pycom13g10040 pycom13g10080 pycom13g16060 pycom13g16080 pycom13g16090 pycom16g09820 pycom16g09830 pycom16g09860 pycom16g09870 pycom16g09880 pycom16g09920
rosa_chinensis RchiOBHm_Chr4g0417141 RchiOBHm_Chr4g0430071 RchiOBHm_Chr4g0430761 RchiOBHm_Chr4g0430771 RchiOBHm_Chr4g0430801 RchiOBHm_Chr4g0430821 RchiOBHm_Chr4g0430841 RchiOBHm_Chr4g0430851 RchiOBHm_Chr4g0431011 RchiOBHm_Chr4g0431021 RchiOBHm_Chr4g0431631 RchiOBHm_Chr4g0431641 RchiOBHm_Chr4g0431651 RchiOBHm_Chr4g0431661 RchiOBHm_Chr4g0431751 RchiOBHm_Chr7g0218001 RchiOBHm_Chr7g0218961 RchiOBHm_Chr7g0222351
rosa_laevigata RLG00000002068 RLG00000002315 RLG00000006893 RLG00000006900 RLG00000006902 RLG00000006934 RLG00000006946 RLG00000006947 RLG00000006949 RLG00000006951 RLG00000007006 RLG00000007007 RLG00000007928 RLG00000008331
rosa_multiflora Rmu_co8203018.1_g000001 Rmu_co8382437.1_g000001 Rmu_co8416363.1_g000001 Rmu_co8420493.1_g000001 Rmu_sc0000131.1_g000002 Rmu_sc0000289.1_g000009 Rmu_sc0001459.1_g000023 Rmu_sc0002620.1_g000010 Rmu_sc0002620.1_g000015 Rmu_sc0002620.1_g000019 Rmu_sc0003823.1_g000013 Rmu_sc0006263.1_g000004 Rmu_sc0007069.1_g000002 Rmu_sc0008769.1_g000020 Rmu_sc0009082.1_g000005 Rmu_sc0009440.1_g000005 Rmu_sc0016424.1_g000002 Rmu_sc0017974.1_g000003 Rmu_sc0023197.1_g000002 Rmu_sc0030497.1_g000002 Rmu_ssc0000150.1_g000031 Rmu_ssc0000340.1_g000006 Rmu_ssc0000487.1_g000004
rosa_roxburghii Rroxscaffold_3G00237050 Rroxscaffold_3G00240290 Rroxscaffold_4G00308920 Rroxscaffold_5G00360950 Rroxscaffold_5G00371870 Rroxscaffold_5G00371880 Rroxscaffold_5G00372470 Rroxscaffold_5G00372500 Rroxscaffold_5G00372510 Rroxscaffold_5G00372520 Rroxscaffold_5G00373090
rosa_rugosa Rorug01G0177500 Rorug03G0283700 Rorug04G0073600 Rorug04G0239800 Rorug04G0245700 Rorug04G0245800 Rorug04G0245800 Rorug04G0245900 Rorug04G0251500 Rorug04G0251600 Rorug04G0252200 Rorug07G0180200 Rorug07G0207700
rosa_samantha Rh4AG208700 Rh4AG296900 Rh4AG301700 Rh4AG301900 Rh4AG302000 Rh4AG302100 Rh4AG302200 Rh4AG304200 Rh4AG308200 Rh4AG308500 Rh4BG167800 Rh4BG205800 Rh4BG303400 Rh4BG309700 Rh4BG309800 Rh4BG310000 Rh4BG310100 Rh4BG310200 Rh4BG310300 Rh4BG315800 Rh4BG316300 Rh4CG219700 Rh4CG318900 Rh4CG326300 Rh4CG326400 Rh4CG326500 Rh4CG326600 Rh4CG331300 Rh7AG315200 Rh7AG323400 Rh7AG350100 Rh7BG314600 Rh7BG339700 Rh7CG332600 Rh7CG340200 Rh7CG340300 Rh7CG367600
rosa_wichuraiana Rw0G015620 Rw4G017690 Rw4G025740 Rw4G026220 Rw4G026240 Rw4G026260 Rw4G026720 Rw4G026730 Rw4G026830 Rw7G027400 Rw7G029550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 140
AclWI GGATC 2 cut(s) 22, 59
AcoI YGGCCR 1 cut(s) 229
AfiI CCNNNNNNNGG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 23
AloI GAACNNNNNNTCC 2 cut(s) 97, 129
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AlwI GGATC 2 cut(s) 22, 59
AoxI GGCC 2 cut(s) 205, 229
AspS9I GGNCC 1 cut(s) 206
AsuHPI GGTGA 1 cut(s) 46
BbsI GAAGAC 1 cut(s) 30
BccI CCATC 2 cut(s) 65, 180
BfaI CTAG 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 206
BmiI GGNNCC 1 cut(s) 208
BpiI GAAGAC 1 cut(s) 30
BsaBI GATNNNNATC 2 cut(s) 13, 56
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse8I GATNNNNATC 2 cut(s) 13, 56
BseGI GGATG 1 cut(s) 57
BseJI GATNNNNATC 2 cut(s) 13, 56
BseLI CCNNNNNNNGG 1 cut(s) 140
BshFI GGCC 2 cut(s) 207, 231
BslI CCNNNNNNNGG 1 cut(s) 140
BsnI GGCC 2 cut(s) 207, 231
Bsp143I GATC 3 cut(s) 14, 51, 156
BspANI GGCC 2 cut(s) 207, 231
BspLI GGNNCC 1 cut(s) 208
BspPI GGATC 2 cut(s) 22, 59
BssMI GATC 3 cut(s) 14, 51, 156
BstDEI CTNAG 1 cut(s) 186
BstF5I GGATG 1 cut(s) 57
BstKTI GATC 3 cut(s) 17, 54, 159
BstMBI GATC 3 cut(s) 14, 51, 156
BstV2I GAAGAC 1 cut(s) 30
BstX2I RGATCY 1 cut(s) 14
BstXI CCANNNNNNTGG 1 cut(s) 203
BstYI RGATCY 1 cut(s) 14
BsuRI GGCC 2 cut(s) 207, 231
BtsCI GGATG 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 206
CspCI CAANNNNNGTGG 2 cut(s) 117, 152
CviJI RGCY 6 cut(s) 65, 112, 127, 190, 207, 231
CviKI_1 RGCY 6 cut(s) 65, 112, 127, 190, 207, 231
DdeI CTNAG 1 cut(s) 186
DpnI GATC 3 cut(s) 16, 53, 158
DpnII GATC 3 cut(s) 14, 51, 156
EaeI YGGCCR 1 cut(s) 229
FaiI YATR 5 cut(s) 12, 30, 35, 204, 212
FokI GGATG 1 cut(s) 44
FspBI CTAG 1 cut(s) 108
HaeIII GGCC 2 cut(s) 207, 231
HindIII AAGCTT 1 cut(s) 188
HinfI GANTC 1 cut(s) 145
HphI GGTGA 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 161
Hpy188III TCNNGA 2 cut(s) 20, 255
HpyCH4V TGCA 1 cut(s) 223
HpyF3I CTNAG 1 cut(s) 186
Kzo9I GATC 3 cut(s) 14, 51, 156
LpnPI CCDG 1 cut(s) 94
MaeI CTAG 1 cut(s) 108
MalI GATC 3 cut(s) 16, 53, 158
MboI GATC 3 cut(s) 14, 51, 156
MboII GAAGA 2 cut(s) 30, 96
MfeI CAATTG 1 cut(s) 243
MflI RGATCY 1 cut(s) 14
MluCI AATT 3 cut(s) 23, 96, 243
MnlI CCTC 1 cut(s) 191
MunI CAATTG 1 cut(s) 243
NdeII GATC 3 cut(s) 14, 51, 156
NlaIV GGNNCC 1 cut(s) 208
NmeAIII GCCGAG 1 cut(s) 207
PfeI GAWTC 1 cut(s) 145
PflMI CCANNNNNTGG 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 208
PspPI GGNCC 1 cut(s) 206
PsuI RGATCY 1 cut(s) 14
Sau3AI GATC 3 cut(s) 14, 51, 156
Sau96I GGNCC 1 cut(s) 206
SetI ASST 1 cut(s) 192
Sse9I AATT 3 cut(s) 23, 96, 243
SspMI CTAG 1 cut(s) 108
TasI AATT 3 cut(s) 23, 96, 243
TfiI GAWTC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 140
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.