Rroxscaffold_5G00371870

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
53379686 .. 53380629
944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00371870.1

Sequence Viewer

Length: 351 bp
ATGGATTTTTTGAGCTCCATACTCTTACATCTTGGCTTAGCCTGGATCTGCAGCCAAGCCTTGCACTATTTACTTGCAAGAAGAAGCAAAGCCATACCCAGAGAGCTTCTTCCACCCGGACCAAAGCCATTTCCATTTGTCGGAAATCTTTTTGAGCTCGGAGGAAAACGCCATCCTTCTTTGACCAAGCTTTCCCGACGCTATGGCCCTATAATCAGTTTGCATCTAGGCCAAGATCTATTTGTTGCTGGGACAGATACAACTTCGGCCACTATGGAGTGGGCAATGGCTGAGCTACTACACAACGTCCCAGAAGTAATGTTGAAAGCTCAAGCTGAGATTGAGGAATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.92

Weight (kDa)

6.97

Isoelectric Point (pI)

53.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 38 - 78 1.5e-06 Cytochrome P450
p450 PF00067 79 - 116 1e-07 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000168)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G61035 AT3G61035 AT3G61035 AT3G61035
fragaria_vesca FvH4_4g24041 FvH4_4g24050 FvH4_4g24050 FvH4_4g24052 FvH4_4g24053 FvH4_4g24060 FvH4_4g24060 FvH4_4g24070 FvH4_4g24080 FvH4_4g24230 FvH4_4g24640 FvH4_4g27900
malus_domestica MD06G1131200.v1.1 MD07G1012100.v1.1 MD12G1099200.v1.1 MD13G1115700.v1.1 MD13G1116100.v1.1 MD16G1115800.v1.1 MD16G1115900.v1.1 MD16G1116200.v1.1 MD16G1116300.v1.1
prunus_persica Prupe.1G229900_v2.0.a1 Prupe.1G230300_v2.0.a1 Prupe.1G230500_v2.0.a1 Prupe.1G230600_v2.0.a1 Prupe.1G230800_v2.0.a1 Prupe.1G230900_v2.0.a1 Prupe.1G231000_v2.0.a1 Prupe.1G231300_v2.0.a1 Prupe.1G231400_v2.0.a1 Prupe.6G237700_v2.0.a1
pyrus_communis pycom13g09840 pycom13g10020 pycom13g10040 pycom13g10080 pycom13g16060 pycom13g16080 pycom13g16090 pycom16g09820 pycom16g09830 pycom16g09860 pycom16g09870 pycom16g09880 pycom16g09920
rosa_chinensis RchiOBHm_Chr4g0417141 RchiOBHm_Chr4g0430071 RchiOBHm_Chr4g0430761 RchiOBHm_Chr4g0430771 RchiOBHm_Chr4g0430801 RchiOBHm_Chr4g0430821 RchiOBHm_Chr4g0430841 RchiOBHm_Chr4g0430851 RchiOBHm_Chr4g0431011 RchiOBHm_Chr4g0431021 RchiOBHm_Chr4g0431631 RchiOBHm_Chr4g0431641 RchiOBHm_Chr4g0431651 RchiOBHm_Chr4g0431661 RchiOBHm_Chr4g0431751 RchiOBHm_Chr7g0218001 RchiOBHm_Chr7g0218961 RchiOBHm_Chr7g0222351
rosa_laevigata RLG00000002068 RLG00000002315 RLG00000006893 RLG00000006900 RLG00000006902 RLG00000006934 RLG00000006946 RLG00000006947 RLG00000006949 RLG00000006951 RLG00000007006 RLG00000007007 RLG00000007928 RLG00000008331
rosa_multiflora Rmu_co8203018.1_g000001 Rmu_co8382437.1_g000001 Rmu_co8416363.1_g000001 Rmu_co8420493.1_g000001 Rmu_sc0000131.1_g000002 Rmu_sc0000289.1_g000009 Rmu_sc0001459.1_g000023 Rmu_sc0002620.1_g000010 Rmu_sc0002620.1_g000015 Rmu_sc0002620.1_g000019 Rmu_sc0003823.1_g000013 Rmu_sc0006263.1_g000004 Rmu_sc0007069.1_g000002 Rmu_sc0008769.1_g000020 Rmu_sc0009082.1_g000005 Rmu_sc0009440.1_g000005 Rmu_sc0016424.1_g000002 Rmu_sc0017974.1_g000003 Rmu_sc0023197.1_g000002 Rmu_sc0030497.1_g000002 Rmu_ssc0000150.1_g000031 Rmu_ssc0000340.1_g000006 Rmu_ssc0000487.1_g000004
rosa_roxburghii Rroxscaffold_3G00237050 Rroxscaffold_3G00240290 Rroxscaffold_4G00308920 Rroxscaffold_5G00360950 Rroxscaffold_5G00371870 Rroxscaffold_5G00371880 Rroxscaffold_5G00372470 Rroxscaffold_5G00372500 Rroxscaffold_5G00372510 Rroxscaffold_5G00372520 Rroxscaffold_5G00373090
rosa_rugosa Rorug01G0177500 Rorug03G0283700 Rorug04G0073600 Rorug04G0239800 Rorug04G0245700 Rorug04G0245800 Rorug04G0245800 Rorug04G0245900 Rorug04G0251500 Rorug04G0251600 Rorug04G0252200 Rorug07G0180200 Rorug07G0207700
rosa_samantha Rh4AG208700 Rh4AG296900 Rh4AG301700 Rh4AG301900 Rh4AG302000 Rh4AG302100 Rh4AG302200 Rh4AG304200 Rh4AG308200 Rh4AG308500 Rh4BG167800 Rh4BG205800 Rh4BG303400 Rh4BG309700 Rh4BG309800 Rh4BG310000 Rh4BG310100 Rh4BG310200 Rh4BG310300 Rh4BG315800 Rh4BG316300 Rh4CG219700 Rh4CG318900 Rh4CG326300 Rh4CG326400 Rh4CG326500 Rh4CG326600 Rh4CG331300 Rh7AG315200 Rh7AG323400 Rh7AG350100 Rh7BG314600 Rh7BG339700 Rh7CG332600 Rh7CG340200 Rh7CG340300 Rh7CG367600
rosa_wichuraiana Rw0G015620 Rw4G017690 Rw4G025740 Rw4G026220 Rw4G026240 Rw4G026260 Rw4G026720 Rw4G026730 Rw4G026830 Rw7G027400 Rw7G029550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 53
AcoI YGGCCR 1 cut(s) 267
AfiI CCNNNNNNNGG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 325
AjnI CCWGG 1 cut(s) 41
AluBI AGCT 7 cut(s) 15, 106, 157, 190, 295, 329, 335
AluI AGCT 7 cut(s) 15, 106, 157, 190, 295, 329, 335
Alw21I GWGCWC 2 cut(s) 17, 159
AlwI GGATC 1 cut(s) 53
AoxI GGCC 3 cut(s) 205, 229, 267
ApeKI GCWGC 1 cut(s) 51
AspS9I GGNCC 2 cut(s) 119, 206
AsuC2I CCSGG 1 cut(s) 117
AvaII GGWCC 1 cut(s) 119
BanII GRGCYC 2 cut(s) 17, 159
Bbv12I GWGCWC 2 cut(s) 17, 159
BbvI GCAGC 1 cut(s) 63
BccI CCATC 1 cut(s) 180
BciT130I CCWGG 1 cut(s) 43
BcnI CCSGG 1 cut(s) 117
BfaI CTAG 1 cut(s) 227
BfmI CTRYAG 1 cut(s) 49
BglII AGATCT 1 cut(s) 235
BisI GCNGC 1 cut(s) 52
BlpI GCTNAGC 2 cut(s) 37, 291
BlsI GCNGC 1 cut(s) 53
Bme1390I CCNGG 2 cut(s) 43, 117
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 2 cut(s) 119, 206
BmrFI CCNGG 2 cut(s) 43, 117
BmsI GCATC 1 cut(s) 232
Bpu1102I GCTNAGC 2 cut(s) 37, 291
BpuEI CTTGAG 1 cut(s) 315
BpuMI CCSGG 1 cut(s) 117
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse3DI GCAATG 1 cut(s) 291
BseBI CCWGG 1 cut(s) 43
BseGI GGATG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 140
BseMI GCAATG 1 cut(s) 291
BseMII CTCAG 2 cut(s) 282, 327
BseXI GCAGC 1 cut(s) 63
BseYI CCCAGC 1 cut(s) 248
BshFI GGCC 3 cut(s) 207, 231, 269
BsiHKAI GWGCWC 2 cut(s) 17, 159
BsiSI CCGG 1 cut(s) 117
BslFI GGGAC 2 cut(s) 265, 293
BslI CCNNNNNNNGG 1 cut(s) 140
BsmFI GGGAC 2 cut(s) 265, 293
BsnI GGCC 3 cut(s) 207, 231, 269
Bsp1286I GDGCHC 2 cut(s) 17, 159
Bsp143I GATC 2 cut(s) 45, 235
Bsp1720I GCTNAGC 2 cut(s) 37, 291
BspANI GGCC 3 cut(s) 207, 231, 269
BspCNI CTCAG 2 cut(s) 283, 328
BspMAI CTGCAG 1 cut(s) 53
BspPI GGATC 1 cut(s) 53
BsrDI GCAATG 1 cut(s) 291
BssMI GATC 2 cut(s) 45, 235
Bst2UI CCWGG 1 cut(s) 43
BstDEI CTNAG 3 cut(s) 37, 291, 336
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 2 cut(s) 48, 238
BstMBI GATC 2 cut(s) 45, 235
BstNI CCWGG 1 cut(s) 43
BstSCI CCNGG 2 cut(s) 41, 115
BstSFI CTRYAG 1 cut(s) 49
BstV1I GCAGC 1 cut(s) 63
BstX2I RGATCY 2 cut(s) 45, 235
BstYI RGATCY 2 cut(s) 45, 235
BsuRI GGCC 3 cut(s) 207, 231, 269
BtsCI GGATG 1 cut(s) 172
Cfr13I GGNCC 2 cut(s) 119, 206
CseI GACGC 1 cut(s) 207
DdeI CTNAG 3 cut(s) 37, 291, 336
DpnI GATC 2 cut(s) 47, 237
DpnII GATC 2 cut(s) 45, 235
EaeI YGGCCR 1 cut(s) 267
Ecl136II GAGCTC 2 cut(s) 15, 157
Eco24I GRGCYC 2 cut(s) 17, 159
Eco47I GGWCC 1 cut(s) 119
Eco53kI GAGCTC 2 cut(s) 15, 157
EcoICRI GAGCTC 2 cut(s) 15, 157
EcoRII CCWGG 1 cut(s) 41
EcoT38I GRGCYC 2 cut(s) 17, 159
FaiI YATR 5 cut(s) 20, 95, 204, 212, 275
FaqI GGGAC 2 cut(s) 265, 293
Fnu4HI GCNGC 1 cut(s) 52
FokI GGATG 1 cut(s) 159
FriOI GRGCYC 2 cut(s) 17, 159
Fsp4HI GCNGC 1 cut(s) 52
FspBI CTAG 1 cut(s) 227
GluI GCNGC 1 cut(s) 52
GsaI CCCAGC 1 cut(s) 252
HaeIII GGCC 3 cut(s) 207, 231, 269
HapII CCGG 1 cut(s) 117
HgaI GACGC 1 cut(s) 207
HindIII AAGCTT 1 cut(s) 188
HpaII CCGG 1 cut(s) 117
Hpy188I TCNGA 2 cut(s) 143, 161
Hpy188III TCNNGA 1 cut(s) 195
Hpy99I CGWCG 1 cut(s) 201
HpyAV CCTTC 1 cut(s) 186
HpyCH4IV ACGT 1 cut(s) 306
HpyCH4V TGCA 4 cut(s) 51, 64, 77, 223
HpyF3I CTNAG 3 cut(s) 37, 291, 336
HpySE526I ACGT 1 cut(s) 306
Kzo9I GATC 2 cut(s) 45, 235
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 6 cut(s) 28, 55, 112, 130, 234, 324
Lsp1109I GCAGC 1 cut(s) 63
LweI GCATC 1 cut(s) 232
MaeI CTAG 1 cut(s) 227
MaeII ACGT 1 cut(s) 306
MalI GATC 2 cut(s) 47, 237
MboI GATC 2 cut(s) 45, 235
MboII GAAGA 2 cut(s) 93, 101
MflI RGATCY 2 cut(s) 45, 235
MhlI GDGCHC 2 cut(s) 17, 159
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 2 cut(s) 155, 337
MspI CCGG 1 cut(s) 117
MspR9I CCNGG 2 cut(s) 43, 117
MvaI CCWGG 1 cut(s) 43
NciI CCSGG 1 cut(s) 117
NdeII GATC 2 cut(s) 45, 235
PkrI GCNGC 1 cut(s) 53
Psp124BI GAGCTC 2 cut(s) 17, 159
Psp6I CCWGG 1 cut(s) 41
PspFI CCCAGC 1 cut(s) 248
PspGI CCWGG 1 cut(s) 41
PspPI GGNCC 2 cut(s) 119, 206
PstI CTGCAG 1 cut(s) 53
PsuI RGATCY 2 cut(s) 45, 235
SacI GAGCTC 2 cut(s) 17, 159
SatI GCNGC 1 cut(s) 52
Sau3AI GATC 2 cut(s) 45, 235
Sau96I GGNCC 2 cut(s) 119, 206
ScrFI CCNGG 2 cut(s) 43, 117
SduI GDGCHC 2 cut(s) 17, 159
SetI ASST 8 cut(s) 17, 108, 159, 192, 297, 309, 331, 337
SfaNI GCATC 1 cut(s) 232
SfcI CTRYAG 1 cut(s) 49
SinI GGWCC 1 cut(s) 119
SmlI CTYRAG 1 cut(s) 330
SmoI CTYRAG 1 cut(s) 330
SspMI CTAG 1 cut(s) 227
SstI GAGCTC 2 cut(s) 17, 159
StyD4I CCNGG 2 cut(s) 41, 115
TaiI ACGT 1 cut(s) 309
TseI GCWGC 1 cut(s) 51
VpaK11BI GGWCC 1 cut(s) 119
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.