Rmu_co8416363.1_g000001

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8416363.1
OG0000168
Physical Location & Seq
Forward (+)
368 .. 940
573 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8416363.1_g000001.1.cds

Sequence Viewer

Length: 573 bp
atggaatgggcaatggctgagctactacgcaacccagaaatcctttcgaaagctcaagcagaacttgagcaagtgattggaaaagggaaactagttgaggaatcagacattgcacgactcccttacttacaagcaataatcaaagaaacatttcgggttcatccaaccgttccatttctactcccccggaaagcagaagcaaacatagagattggtggttatataatcccaaagggtgcacgagttctaatcaatttttgggccataagcagagaccccatcacttgggacaacccaaacttgtttatgcctgagaggttcctgggattagacaaccaaattgatgttacggggaaaaactttgagcttattccatttggtggtgggaggagaatatgtcctggacttccattggcaataagaatgctgtacttgatgttgggttcattaattaactgttttgattgggagcttgaagatggagttgtacccgagactatgaacatggaagataagtttggcctcaccttacaaatggctcagcctctgagagctgtgcccaagaagttatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0004497 GO:0005575 GO:0008150 GO:0008152 GO:0009058 GO:0016020 GO:0016491 GO:0016705 GO:0016709 GO:0019748 GO:0044550 GO:0055114
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
p450

Protein Analysis

190

Amino Acids

21.53

Weight (kDa)

5.34

Isoelectric Point (pI)

40.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000168)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G61035 AT3G61035 AT3G61035 AT3G61035
fragaria_vesca FvH4_4g24041 FvH4_4g24050 FvH4_4g24050 FvH4_4g24052 FvH4_4g24053 FvH4_4g24060 FvH4_4g24060 FvH4_4g24070 FvH4_4g24080 FvH4_4g24230 FvH4_4g24640 FvH4_4g27900
malus_domestica MD06G1131200.v1.1 MD07G1012100.v1.1 MD12G1099200.v1.1 MD13G1115700.v1.1 MD13G1116100.v1.1 MD16G1115800.v1.1 MD16G1115900.v1.1 MD16G1116200.v1.1 MD16G1116300.v1.1
prunus_persica Prupe.1G229900_v2.0.a1 Prupe.1G230300_v2.0.a1 Prupe.1G230500_v2.0.a1 Prupe.1G230600_v2.0.a1 Prupe.1G230800_v2.0.a1 Prupe.1G230900_v2.0.a1 Prupe.1G231000_v2.0.a1 Prupe.1G231300_v2.0.a1 Prupe.1G231400_v2.0.a1 Prupe.6G237700_v2.0.a1
pyrus_communis pycom13g09840 pycom13g10020 pycom13g10040 pycom13g10080 pycom13g16060 pycom13g16080 pycom13g16090 pycom16g09820 pycom16g09830 pycom16g09860 pycom16g09870 pycom16g09880 pycom16g09920
rosa_chinensis RchiOBHm_Chr4g0417141 RchiOBHm_Chr4g0430071 RchiOBHm_Chr4g0430761 RchiOBHm_Chr4g0430771 RchiOBHm_Chr4g0430801 RchiOBHm_Chr4g0430821 RchiOBHm_Chr4g0430841 RchiOBHm_Chr4g0430851 RchiOBHm_Chr4g0431011 RchiOBHm_Chr4g0431021 RchiOBHm_Chr4g0431631 RchiOBHm_Chr4g0431641 RchiOBHm_Chr4g0431651 RchiOBHm_Chr4g0431661 RchiOBHm_Chr4g0431751 RchiOBHm_Chr7g0218001 RchiOBHm_Chr7g0218961 RchiOBHm_Chr7g0222351
rosa_laevigata RLG00000002068 RLG00000002315 RLG00000006893 RLG00000006900 RLG00000006902 RLG00000006934 RLG00000006946 RLG00000006947 RLG00000006949 RLG00000006951 RLG00000007006 RLG00000007007 RLG00000007928 RLG00000008331
rosa_multiflora Rmu_co8203018.1_g000001 Rmu_co8382437.1_g000001 Rmu_co8416363.1_g000001 Rmu_co8420493.1_g000001 Rmu_sc0000131.1_g000002 Rmu_sc0000289.1_g000009 Rmu_sc0001459.1_g000023 Rmu_sc0002620.1_g000010 Rmu_sc0002620.1_g000015 Rmu_sc0002620.1_g000019 Rmu_sc0003823.1_g000013 Rmu_sc0006263.1_g000004 Rmu_sc0007069.1_g000002 Rmu_sc0008769.1_g000020 Rmu_sc0009082.1_g000005 Rmu_sc0009440.1_g000005 Rmu_sc0016424.1_g000002 Rmu_sc0017974.1_g000003 Rmu_sc0023197.1_g000002 Rmu_sc0030497.1_g000002 Rmu_ssc0000150.1_g000031 Rmu_ssc0000340.1_g000006 Rmu_ssc0000487.1_g000004
rosa_roxburghii Rroxscaffold_3G00237050 Rroxscaffold_3G00240290 Rroxscaffold_4G00308920 Rroxscaffold_5G00360950 Rroxscaffold_5G00371870 Rroxscaffold_5G00371880 Rroxscaffold_5G00372470 Rroxscaffold_5G00372500 Rroxscaffold_5G00372510 Rroxscaffold_5G00372520 Rroxscaffold_5G00373090
rosa_rugosa Rorug01G0177500 Rorug03G0283700 Rorug04G0073600 Rorug04G0239800 Rorug04G0245700 Rorug04G0245800 Rorug04G0245800 Rorug04G0245900 Rorug04G0251500 Rorug04G0251600 Rorug04G0252200 Rorug07G0180200 Rorug07G0207700
rosa_samantha Rh4AG208700 Rh4AG296900 Rh4AG301700 Rh4AG301900 Rh4AG302000 Rh4AG302100 Rh4AG302200 Rh4AG304200 Rh4AG308200 Rh4AG308500 Rh4BG167800 Rh4BG205800 Rh4BG303400 Rh4BG309700 Rh4BG309800 Rh4BG310000 Rh4BG310100 Rh4BG310200 Rh4BG310300 Rh4BG315800 Rh4BG316300 Rh4CG219700 Rh4CG318900 Rh4CG326300 Rh4CG326400 Rh4CG326500 Rh4CG326600 Rh4CG331300 Rh7AG315200 Rh7AG323400 Rh7AG350100 Rh7BG314600 Rh7BG339700 Rh7CG332600 Rh7CG340200 Rh7CG340300 Rh7CG367600
rosa_wichuraiana Rw0G015620 Rw4G017690 Rw4G025740 Rw4G026220 Rw4G026240 Rw4G026260 Rw4G026720 Rw4G026730 Rw4G026830 Rw7G027400 Rw7G029550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 285, 380
AfaI GTAC 2 cut(s) 431, 489
AfiI CCNNNNNNNGG 2 cut(s) 285, 380
AgsI TTSAA 1 cut(s) 476
AhlI ACTAGT 1 cut(s) 91
AjnI CCWGG 2 cut(s) 321, 400
AjuI GAANNNNNNNTTGG 2 cut(s) 501, 533
AluBI AGCT 5 cut(s) 22, 53, 367, 472, 554
AluI AGCT 5 cut(s) 22, 53, 367, 472, 554
Alw21I GWGCWC 1 cut(s) 241
Alw26I GTCTC 2 cut(s) 267, 488
Alw44I GTGCAC 1 cut(s) 237
AlwNI CAGNNNCTG 1 cut(s) 547
Ama87I CYCGRG 1 cut(s) 491
AoxI GGCC 2 cut(s) 261, 520
ApaLI GTGCAC 1 cut(s) 237
AseI ATTAAT 1 cut(s) 449
Asp700I GAANNNNTTC 1 cut(s) 150
AspS9I GGNCC 1 cut(s) 261
AsuC2I CCSGG 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 517
AsuII TTCGAA 1 cut(s) 47
AvaI CYCGRG 1 cut(s) 491
BaeGI GKGCMC 2 cut(s) 241, 561
BauI CACGAG 1 cut(s) 240
Bbv12I GWGCWC 1 cut(s) 241
BccI CCATC 2 cut(s) 287, 473
BciT130I CCWGG 2 cut(s) 323, 402
BcnI CCSGG 1 cut(s) 187
BcoDI GTCTC 2 cut(s) 267, 488
BcuI ACTAGT 1 cut(s) 91
BfaI CTAG 1 cut(s) 92
BlpI GCTNAGC 2 cut(s) 18, 540
Bme1390I CCNGG 3 cut(s) 187, 323, 402
BmeT110I CYCGRG 1 cut(s) 491
BmgT120I GGNCC 1 cut(s) 261
BmiI GGNNCC 1 cut(s) 320
BmrFI CCNGG 3 cut(s) 187, 323, 402
Bpu1102I GCTNAGC 2 cut(s) 18, 540
Bpu14I TTCGAA 1 cut(s) 47
BpuEI CTTGAG 2 cut(s) 39, 86
BpuMI CCSGG 1 cut(s) 187
BsaI GGTCTC 1 cut(s) 267
BsaJI CCNNGG 2 cut(s) 185, 322
BsaXI ACNNNNNCTCC 2 cut(s) 382, 412
Bsc4I CCNNNNNNNGG 2 cut(s) 285, 380
Bse3DI GCAATG 2 cut(s) 18, 108
BseBI CCWGG 2 cut(s) 323, 402
BseDI CCNNGG 2 cut(s) 185, 322
BseGI GGATG 1 cut(s) 160
BseLI CCNNNNNNNGG 2 cut(s) 285, 380
BseMI GCAATG 2 cut(s) 18, 108
BseMII CTCAG 4 cut(s) 9, 303, 539, 554
BseRI GAGGAG 1 cut(s) 403
BseSI GKGCMC 2 cut(s) 241, 561
BshFI GGCC 2 cut(s) 263, 522
BsiHKAI GWGCWC 1 cut(s) 241
BsiHKCI CYCGRG 1 cut(s) 491
BsiSI CCGG 1 cut(s) 187
BslFI GGGAC 1 cut(s) 302
BslI CCNNNNNNNGG 2 cut(s) 285, 380
BsmAI GTCTC 2 cut(s) 267, 488
BsmFI GGGAC 1 cut(s) 302
BsmI GAATGC 1 cut(s) 429
BsnI GGCC 2 cut(s) 263, 522
Bso31I GGTCTC 1 cut(s) 267
BsoBI CYCGRG 1 cut(s) 491
Bsp119I TTCGAA 1 cut(s) 47
Bsp1286I GDGCHC 2 cut(s) 241, 561
Bsp1720I GCTNAGC 2 cut(s) 18, 540
BspANI GGCC 2 cut(s) 263, 522
BspCNI CTCAG 4 cut(s) 10, 304, 540, 553
BspLI GGNNCC 1 cut(s) 320
BspT104I TTCGAA 1 cut(s) 47
BspTNI GGTCTC 1 cut(s) 267
BsrDI GCAATG 2 cut(s) 18, 108
BssECI CCNNGG 2 cut(s) 185, 322
BssSI CACGAG 1 cut(s) 240
Bst2BI CACGAG 1 cut(s) 240
Bst2UI CCWGG 2 cut(s) 323, 402
Bst4CI ACNGT 2 cut(s) 169, 458
BstBI TTCGAA 1 cut(s) 47
BstDEI CTNAG 4 cut(s) 18, 312, 540, 548
BstF5I GGATG 1 cut(s) 160
BstMAI GTCTC 2 cut(s) 267, 488
BstNI CCWGG 2 cut(s) 323, 402
BstSCI CCNGG 3 cut(s) 185, 321, 400
BstSLI GKGCMC 2 cut(s) 241, 561
BsuRI GGCC 2 cut(s) 263, 522
BtsCI GGATG 1 cut(s) 160
CaiI CAGNNNCTG 1 cut(s) 547
Cfr13I GGNCC 1 cut(s) 261
Csp6I GTAC 2 cut(s) 430, 488
CviAII CATG 1 cut(s) 505
CviQI GTAC 2 cut(s) 430, 488
DdeI CTNAG 4 cut(s) 18, 312, 540, 548
Eco31I GGTCTC 1 cut(s) 267
Eco88I CYCGRG 1 cut(s) 491
EcoRII CCWGG 2 cut(s) 321, 400
FaeI CATG 1 cut(s) 508
FaiI YATR 9 cut(s) 206, 222, 224, 266, 308, 397, 500, 506, 571
FalI AAGNNNNNCTT 2 cut(s) 48, 80
FaqI GGGAC 1 cut(s) 302
FatI CATG 1 cut(s) 504
FokI GGATG 1 cut(s) 147
FspBI CTAG 1 cut(s) 92
HaeIII GGCC 2 cut(s) 263, 522
HapII CCGG 1 cut(s) 187
Hin1II CATG 1 cut(s) 508
HinfI GANTC 2 cut(s) 101, 117
HpaII CCGG 1 cut(s) 187
HphI GGTGA 1 cut(s) 517
Hpy166II GTNNAC 1 cut(s) 239
Hpy188I TCNGA 2 cut(s) 106, 549
Hpy8I GTNNAC 1 cut(s) 239
HpyCH4III ACNGT 2 cut(s) 169, 458
HpyCH4V TGCA 2 cut(s) 113, 239
HpyF3I CTNAG 4 cut(s) 18, 312, 540, 548
Hsp92II CATG 1 cut(s) 508
LmnI GCTCC 1 cut(s) 469
LpnPI CCDG 7 cut(s) 48, 200, 308, 324, 335, 387, 414
MaeI CTAG 1 cut(s) 92
MaeIII GTNAC 1 cut(s) 346
MboII GAAGA 2 cut(s) 488, 521
MhlI GDGCHC 2 cut(s) 241, 561
MluCI AATT 3 cut(s) 253, 339, 450
MlyI GAGTC 1 cut(s) 111
MmeI TCCRAC 1 cut(s) 188
MnlI CCTC 5 cut(s) 91, 309, 381, 533, 555
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 2 cut(s) 449, 453
MspI CCGG 1 cut(s) 187
MspR9I CCNGG 3 cut(s) 187, 323, 402
Mva1269I GAATGC 1 cut(s) 429
MvaI CCWGG 2 cut(s) 323, 402
NciI CCSGG 1 cut(s) 187
NlaIII CATG 1 cut(s) 508
NlaIV GGNNCC 1 cut(s) 320
NspV TTCGAA 1 cut(s) 47
PacI TTAATTAA 1 cut(s) 453
PctI GAATGC 1 cut(s) 429
PdmI GAANNNNTTC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 101
PflMI CCANNNNNTGG 2 cut(s) 285, 380
PfoI TCCNGGA 1 cut(s) 400
PleI GAGTC 1 cut(s) 111
PpsI GAGTC 1 cut(s) 111
PshBI ATTAAT 1 cut(s) 449
Psp6I CCWGG 2 cut(s) 321, 400
PspGI CCWGG 2 cut(s) 321, 400
PspN4I GGNNCC 1 cut(s) 320
PspPI GGNCC 1 cut(s) 261
PstNI CAGNNNCTG 1 cut(s) 547
RsaI GTAC 2 cut(s) 431, 489
RsaNI GTAC 2 cut(s) 430, 488
SaqAI TTAA 2 cut(s) 449, 453
Sau96I GGNCC 1 cut(s) 261
SchI GAGTC 1 cut(s) 111
ScrFI CCNGG 3 cut(s) 187, 323, 402
SduI GDGCHC 2 cut(s) 241, 561
SetI ASST 7 cut(s) 24, 55, 320, 369, 474, 530, 556
SfuI TTCGAA 1 cut(s) 47
SmlI CTYRAG 2 cut(s) 54, 65
SmoI CTYRAG 2 cut(s) 54, 65
SpeI ACTAGT 1 cut(s) 91
Sse9I AATT 3 cut(s) 253, 339, 450
SspMI CTAG 1 cut(s) 92
StyD4I CCNGG 3 cut(s) 185, 321, 400
TaaI ACNGT 2 cut(s) 169, 458
TaqI TCGA 1 cut(s) 47
TasI AATT 3 cut(s) 253, 339, 450
TatI WGTACW 1 cut(s) 429
TfiI GAWTC 1 cut(s) 101
Tru1I TTAA 2 cut(s) 449, 453
Tru9I TTAA 2 cut(s) 449, 453
TspDTI ATGAA 3 cut(s) 149, 435, 515
Van91I CCANNNNNTGG 2 cut(s) 285, 380
VneI GTGCAC 1 cut(s) 237
VspI ATTAAT 1 cut(s) 449
XmnI GAANNNNTTC 1 cut(s) 150
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.