Rmu_sc0000950.1_g000029

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000950.1
OG0000480
Physical Location & Seq
Reverse (-)
99309 .. 100671
1363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000950.1_g000029.1.cds

Sequence Viewer

Length: 615 bp
atgttaaaaaatgatttggctttggtaactcgaagtaaagatgaggagttcgaaaagggggtcgccaaaatgaagcgtgtgtccgccaaacatttccgactcggatggaaccaggccttgactaaagaagatgatagatgctacgtagggcctgacgaattcgaccgcttctatggggtttgcccccaaggactattctcctattcgtggtatgctaccgggggatgctccttcgtaggcgtcgagcgcttccgaggggcccggtcctacaaacacttagggggattctcatctgatttcaacactcgccaattccttgaggatgtgttgaactatcccgacgatggccaggtgagtgctcctcgtgcttcgaaggctcatgccgatcctagtcggcctcgtcgtcagagcatgagtactgacaggggaacaagtcctgaatcccatcgtctccgtactctgagagaggaatctttcatgctacaggattcgctcgagcatgccctgtcggaggcccgcaatctggaggctgaggtccataacctgttgctggagcttcaacgcttgagggaccatgcagagtgtctgaaagtagagctccgcaaatgttactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

204

Amino Acids

23.5

Weight (kDa)

7.69

Isoelectric Point (pI)

52.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000480)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04502
rosa_chinensis RchiOBHm_Chr2g0159401 RchiOBHm_Chr6g0254061
rosa_laevigata RLG00000014946 RLG00000035644 RLG00000035648
rosa_multiflora Rmu_co7989044.1_g000001 Rmu_co8071304.1_g000001 Rmu_co8335039.1_g000001 Rmu_co8433837.1_g000001 Rmu_co8463157.1_g000003 Rmu_co8495873.1_g000001 Rmu_sc0000030.1_g000034 Rmu_sc0000335.1_g000030 Rmu_sc0000386.1_g000004 Rmu_sc0000419.1_g000026 Rmu_sc0000536.1_g000025 Rmu_sc0000693.1_g000045 Rmu_sc0000950.1_g000029 Rmu_sc0000950.1_g000030 Rmu_sc0001524.1_g000001 Rmu_sc0001524.1_g000002 Rmu_sc0001716.1_g000027 Rmu_sc0001744.1_g000019 Rmu_sc0002162.1_g000032 Rmu_sc0002300.1_g000003 Rmu_sc0002341.1_g000002 Rmu_sc0002480.1_g000026 Rmu_sc0002759.1_g000071 Rmu_sc0002837.1_g000002 Rmu_sc0002837.1_g000003 Rmu_sc0002986.1_g000030 Rmu_sc0002986.1_g000031 Rmu_sc0003553.1_g000001 Rmu_sc0004192.1_g000015 Rmu_sc0004322.1_g000020 Rmu_sc0004755.1_g000032 Rmu_sc0004755.1_g000034 Rmu_sc0005163.1_g000005 Rmu_sc0005507.1_g000023 Rmu_sc0005599.1_g000013 Rmu_sc0005599.1_g000014 Rmu_sc0005599.1_g000015 Rmu_sc0005947.1_g000011 Rmu_sc0006031.1_g000027 Rmu_sc0006287.1_g000035 Rmu_sc0006318.1_g000009 Rmu_sc0007355.1_g000006 Rmu_sc0007355.1_g000007 Rmu_sc0007646.1_g000003 Rmu_sc0007953.1_g000003 Rmu_sc0008084.1_g000003 Rmu_sc0009135.1_g000005 Rmu_sc0009656.1_g000001 Rmu_sc0010871.1_g000011 Rmu_sc0010871.1_g000012 Rmu_sc0011938.1_g000002 Rmu_sc0013472.1_g000004 Rmu_sc0014143.1_g000001 Rmu_sc0015550.1_g000001 Rmu_sc0015855.1_g000002 Rmu_sc0017748.1_g000001 Rmu_sc0031144.1_g000001 Rmu_sc0032350.1_g000002 Rmu_sc0036344.1_g000003 Rmu_ssc0000042.1_g000002 Rmu_ssc0000255.1_g000043
rosa_roxburghii Rroxscaffold_1G00012780 Rroxscaffold_1G00031520 Rroxscaffold_1G00044950 Rroxscaffold_1G00044960 Rroxscaffold_2G00117760 Rroxscaffold_3G00224840 Rroxscaffold_3G00225760 Rroxscaffold_3G00235510 Rroxscaffold_3G00265420 Rroxscaffold_4G00315210 Rroxscaffold_4G00322430 Rroxscaffold_7G00165660 Rroxscaffold_7G00195200 Rroxscaffold_7G00211270
rosa_rugosa Rorug05G0252000 Rorug05G0548900
rosa_samantha Rh6AG065700 Rh6BG058500 Rh6CG058900 Rh6DG055700 Rh7DG180100
rosa_wichuraiana Rw6G005780 Rw6G033910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 84, 166, 517, 601
AclWI GGATC 1 cut(s) 380
AcoI YGGCCR 1 cut(s) 346
AcsI RAATTY 1 cut(s) 158
AcyI GRCGYC 1 cut(s) 240
AfaI GTAC 2 cut(s) 418, 457
AfeI AGCGCT 1 cut(s) 248
AfiI CCNNNNNNNGG 5 cut(s) 207, 344, 511, 523, 550
AgsI TTSAA 3 cut(s) 301, 331, 560
AjnI CCWGG 2 cut(s) 111, 348
AluBI AGCT 2 cut(s) 556, 598
AluI AGCT 2 cut(s) 556, 598
Alw21I GWGCWC 2 cut(s) 361, 600
Alw26I GTCTC 1 cut(s) 455
AlwI GGATC 1 cut(s) 380
Ama87I CYCGRG 1 cut(s) 494
Aor51HI AGCGCT 1 cut(s) 248
AoxI GGCC 6 cut(s) 114, 149, 258, 346, 395, 513
ApaI GGGCCC 1 cut(s) 262
ApoI RAATTY 1 cut(s) 158
ArsI GACNNNNNNTTYG 2 cut(s) 45, 77
AspLEI GCGC 1 cut(s) 249
AspS9I GGNCC 7 cut(s) 149, 258, 259, 264, 514, 535, 571
AsuC2I CCSGG 2 cut(s) 220, 262
AsuHPI GGTGA 1 cut(s) 364
AsuII TTCGAA 2 cut(s) 51, 371
AvaI CYCGRG 1 cut(s) 494
AvaII GGWCC 3 cut(s) 264, 535, 571
BaeGI GKGCMC 1 cut(s) 262
BalI TGGCCA 1 cut(s) 348
BanII GRGCYC 2 cut(s) 262, 600
BauI CACGAG 1 cut(s) 363
Bbv12I GWGCWC 2 cut(s) 361, 600
BbvCI CCTCAGC 1 cut(s) 531
BccI CCATC 3 cut(s) 99, 338, 453
BciT130I CCWGG 2 cut(s) 113, 350
BcnI CCSGG 2 cut(s) 220, 262
BcoDI GTCTC 1 cut(s) 455
BfaI CTAG 1 cut(s) 390
BfmI CTRYAG 1 cut(s) 482
BfoI RGCGCY 1 cut(s) 250
BmcAI AGTACT 1 cut(s) 418
Bme1390I CCNGG 4 cut(s) 113, 220, 262, 350
Bme18I GGWCC 3 cut(s) 264, 535, 571
BmeT110I CYCGRG 1 cut(s) 494
BmgT120I GGNCC 7 cut(s) 149, 258, 259, 264, 514, 535, 571
BmiI GGNNCC 4 cut(s) 110, 259, 260, 572
BmrFI CCNGG 4 cut(s) 113, 220, 262, 350
BmsI GCATC 2 cut(s) 128, 215
BplI GAGNNNNNCTC 2 cut(s) 346, 378
BpmI CTGGAG 2 cut(s) 545, 572
Bpu10I CCTNAGC 1 cut(s) 531
Bpu14I TTCGAA 2 cut(s) 51, 371
BpuEI CTTGAG 2 cut(s) 338, 586
BpuMI CCSGG 2 cut(s) 220, 262
BsaAI YACGTR 1 cut(s) 145
BsaBI GATNNNNATC 1 cut(s) 289
BsaHI GRCGYC 1 cut(s) 240
BsaJI CCNNGG 3 cut(s) 187, 219, 253
Bsc4I CCNNNNNNNGG 5 cut(s) 207, 344, 511, 523, 550
Bse8I GATNNNNATC 1 cut(s) 289
BseBI CCWGG 2 cut(s) 113, 350
BseDI CCNNGG 3 cut(s) 187, 219, 253
BseGI GGATG 3 cut(s) 110, 230, 328
BseJI GATNNNNATC 1 cut(s) 289
BseLI CCNNNNNNNGG 5 cut(s) 207, 344, 511, 523, 550
BseMII CTCAG 2 cut(s) 452, 522
BseRI GAGGAG 2 cut(s) 59, 351
BseSI GKGCMC 1 cut(s) 262
Bsh1285I CGRYCG 1 cut(s) 166
BshFI GGCC 6 cut(s) 116, 151, 260, 348, 397, 515
BsiEI CGRYCG 1 cut(s) 166
BsiHKAI GWGCWC 2 cut(s) 361, 600
BsiHKCI CYCGRG 1 cut(s) 494
BsiSI CCGG 2 cut(s) 219, 262
BslFI GGGAC 1 cut(s) 584
BslI CCNNNNNNNGG 5 cut(s) 207, 344, 511, 523, 550
BsmAI GTCTC 1 cut(s) 455
BsmBI CGTCTC 1 cut(s) 455
BsmFI GGGAC 1 cut(s) 584
BsnI GGCC 6 cut(s) 116, 151, 260, 348, 397, 515
BsoBI CYCGRG 1 cut(s) 494
Bsp119I TTCGAA 2 cut(s) 51, 371
Bsp120I GGGCCC 1 cut(s) 258
Bsp1286I GDGCHC 3 cut(s) 262, 361, 600
Bsp143I GATC 1 cut(s) 385
BspACI CCGC 4 cut(s) 84, 166, 517, 601
BspANI GGCC 6 cut(s) 116, 151, 260, 348, 397, 515
BspCNI CTCAG 2 cut(s) 453, 523
BspLI GGNNCC 4 cut(s) 110, 259, 260, 572
BspPI GGATC 1 cut(s) 380
BspT104I TTCGAA 2 cut(s) 51, 371
BssECI CCNNGG 3 cut(s) 187, 219, 253
BssMI GATC 1 cut(s) 385
BssNI GRCGYC 1 cut(s) 240
BssSI CACGAG 1 cut(s) 363
BssT1I CCWWGG 1 cut(s) 187
Bst2BI CACGAG 1 cut(s) 363
Bst2UI CCWGG 2 cut(s) 113, 350
BstACI GRCGYC 1 cut(s) 240
BstBAI YACGTR 1 cut(s) 145
BstBI TTCGAA 2 cut(s) 51, 371
BstC8I GCNNGC 2 cut(s) 501, 517
BstDEI CTNAG 3 cut(s) 277, 461, 531
BstENI CCTNNNNNAGG 1 cut(s) 509
BstF5I GGATG 3 cut(s) 110, 230, 328
BstH2I RGCGCY 1 cut(s) 250
BstHHI GCGC 1 cut(s) 249
BstKTI GATC 1 cut(s) 388
BstMAI GTCTC 1 cut(s) 455
BstMBI GATC 1 cut(s) 385
BstMCI CGRYCG 1 cut(s) 166
BstMWI GCNNNNNNNGC 3 cut(s) 246, 365, 374
BstNI CCWGG 2 cut(s) 113, 350
BstNSI RCATGY 1 cut(s) 503
BstSCI CCNGG 4 cut(s) 111, 218, 260, 348
BstSFI CTRYAG 1 cut(s) 482
BstSLI GKGCMC 1 cut(s) 262
BstSNI TACGTA 1 cut(s) 145
BsuRI GGCC 6 cut(s) 116, 151, 260, 348, 397, 515
BtsCI GGATG 3 cut(s) 110, 230, 328
Cac8I GCNNGC 2 cut(s) 501, 517
CfoI GCGC 1 cut(s) 249
Cfr13I GGNCC 7 cut(s) 149, 258, 259, 264, 514, 535, 571
CseI GACGC 1 cut(s) 229
Csp6I GTAC 2 cut(s) 417, 456
CviAII CATG 5 cut(s) 380, 412, 478, 500, 575
CviQI GTAC 2 cut(s) 417, 456
DdeI CTNAG 3 cut(s) 277, 461, 531
DpnI GATC 1 cut(s) 387
DpnII GATC 1 cut(s) 385
EaeI YGGCCR 1 cut(s) 346
EciI GGCGGA 1 cut(s) 73
Ecl136II GAGCTC 1 cut(s) 598
Eco105I TACGTA 1 cut(s) 145
Eco130I CCWWGG 1 cut(s) 187
Eco147I AGGCCT 1 cut(s) 116
Eco24I GRGCYC 2 cut(s) 262, 600
Eco47I GGWCC 3 cut(s) 264, 535, 571
Eco47III AGCGCT 1 cut(s) 248
Eco53kI GAGCTC 1 cut(s) 598
Eco88I CYCGRG 1 cut(s) 494
EcoICRI GAGCTC 1 cut(s) 598
EcoNI CCTNNNNNAGG 1 cut(s) 509
EcoO109I RGGNCCY 2 cut(s) 149, 258
EcoRI GAATTC 1 cut(s) 158
EcoRII CCWGG 2 cut(s) 111, 348
EcoT14I CCWWGG 1 cut(s) 187
EcoT38I GRGCYC 2 cut(s) 262, 600
ErhI CCWWGG 1 cut(s) 187
Esp3I CGTCTC 1 cut(s) 455
FaeI CATG 5 cut(s) 383, 415, 481, 503, 578
FaiI YATR 8 cut(s) 174, 213, 381, 413, 479, 501, 540, 576
FaqI GGGAC 1 cut(s) 584
FatI CATG 5 cut(s) 379, 411, 477, 499, 574
FauI CCCGC 1 cut(s) 524
FokI GGATG 3 cut(s) 117, 237, 335
FriOI GRGCYC 2 cut(s) 262, 600
FspBI CTAG 1 cut(s) 390
GlaI GCGC 1 cut(s) 248
GsuI CTGGAG 2 cut(s) 545, 572
HaeII RGCGCY 1 cut(s) 250
HaeIII GGCC 6 cut(s) 116, 151, 260, 348, 397, 515
HapII CCGG 2 cut(s) 219, 262
HgaI GACGC 1 cut(s) 229
HhaI GCGC 1 cut(s) 249
Hin1I GRCGYC 1 cut(s) 240
Hin1II CATG 5 cut(s) 383, 415, 481, 503, 578
Hin6I GCGC 1 cut(s) 247
HinP1I GCGC 1 cut(s) 247
HinfI GANTC 5 cut(s) 99, 285, 440, 470, 488
HpaII CCGG 2 cut(s) 219, 262
HphI GGTGA 1 cut(s) 364
Hpy188I TCNGA 8 cut(s) 98, 104, 254, 295, 408, 462, 511, 588
Hpy188III TCNNGA 3 cut(s) 338, 437, 524
Hpy99I CGWCG 3 cut(s) 245, 344, 405
HpyAV CCTTC 2 cut(s) 241, 367
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 578
HpyF10VI GCNNNNNNNGC 3 cut(s) 246, 365, 374
HpyF3I CTNAG 3 cut(s) 277, 461, 531
HpySE526I ACGT 1 cut(s) 144
Hsp92I GRCGYC 1 cut(s) 240
Hsp92II CATG 5 cut(s) 383, 415, 481, 503, 578
HspAI GCGC 1 cut(s) 247
Kzo9I GATC 1 cut(s) 385
LmnI GCTCC 4 cut(s) 233, 364, 553, 603
LweI GCATC 2 cut(s) 128, 215
MaeI CTAG 1 cut(s) 390
MaeII ACGT 1 cut(s) 144
MaeIII GTNAC 2 cut(s) 25, 608
MalI GATC 1 cut(s) 387
MboI GATC 1 cut(s) 385
MboII GAAGA 1 cut(s) 140
MhlI GDGCHC 3 cut(s) 262, 361, 600
MlsI TGGCCA 1 cut(s) 348
MluCI AATT 2 cut(s) 158, 311
MluNI TGGCCA 1 cut(s) 348
MlyI GAGTC 1 cut(s) 93
MmeI TCCRAC 2 cut(s) 121, 489
Mox20I TGGCCA 1 cut(s) 348
MscI TGGCCA 1 cut(s) 348
MseI TTAA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 348
MspI CCGG 2 cut(s) 219, 262
MspR9I CCNGG 4 cut(s) 113, 220, 262, 350
MvaI CCWGG 2 cut(s) 113, 350
MwoI GCNNNNNNNGC 3 cut(s) 246, 365, 374
NciI CCSGG 2 cut(s) 220, 262
NdeII GATC 1 cut(s) 385
NlaIII CATG 5 cut(s) 383, 415, 481, 503, 578
NlaIV GGNNCC 4 cut(s) 110, 259, 260, 572
NspI RCATGY 1 cut(s) 503
NspV TTCGAA 2 cut(s) 51, 371
PaeI GCATGC 1 cut(s) 503
PaeR7I CTCGAG 1 cut(s) 494
PceI AGGCCT 1 cut(s) 116
PcsI WCGNNNNNNNCGW 2 cut(s) 240, 400
PfeI GAWTC 4 cut(s) 285, 440, 470, 488
PleI GAGTC 1 cut(s) 93
PpsI GAGTC 1 cut(s) 93
Ppu21I YACGTR 1 cut(s) 145
Psp124BI GAGCTC 1 cut(s) 600
Psp6I CCWGG 2 cut(s) 111, 348
PspGI CCWGG 2 cut(s) 111, 348
PspN4I GGNNCC 4 cut(s) 110, 259, 260, 572
PspOMI GGGCCC 1 cut(s) 258
PspPI GGNCC 7 cut(s) 149, 258, 259, 264, 514, 535, 571
PspXI VCTCGAGB 1 cut(s) 494
RsaI GTAC 2 cut(s) 418, 457
RsaNI GTAC 2 cut(s) 417, 456
SacI GAGCTC 1 cut(s) 600
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 1 cut(s) 385
Sau96I GGNCC 7 cut(s) 149, 258, 259, 264, 514, 535, 571
ScaI AGTACT 1 cut(s) 418
SchI GAGTC 1 cut(s) 93
ScrFI CCNGG 4 cut(s) 113, 220, 262, 350
SduI GDGCHC 3 cut(s) 262, 361, 600
SetI ASST 6 cut(s) 147, 354, 537, 546, 558, 600
SfaNI GCATC 2 cut(s) 128, 215
SfcI CTRYAG 1 cut(s) 482
Sfr274I CTCGAG 1 cut(s) 494
SfuI TTCGAA 2 cut(s) 51, 371
SinI GGWCC 3 cut(s) 264, 535, 571
SlaI CTCGAG 1 cut(s) 494
SmlI CTYRAG 3 cut(s) 317, 494, 565
SmoI CTYRAG 3 cut(s) 317, 494, 565
SnaBI TACGTA 1 cut(s) 145
SphI GCATGC 1 cut(s) 503
Sse9I AATT 2 cut(s) 158, 311
SseBI AGGCCT 1 cut(s) 116
SsiI CCGC 4 cut(s) 84, 166, 517, 601
SspMI CTAG 1 cut(s) 390
SstI GAGCTC 1 cut(s) 600
StuI AGGCCT 1 cut(s) 116
StyD4I CCNGG 4 cut(s) 111, 218, 260, 348
StyI CCWWGG 1 cut(s) 187
TaiI ACGT 1 cut(s) 147
TaqI TCGA 6 cut(s) 31, 51, 162, 243, 371, 495
TasI AATT 2 cut(s) 158, 311
TatI WGTACW 1 cut(s) 416
TfiI GAWTC 4 cut(s) 285, 440, 470, 488
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TspDTI ATGAA 2 cut(s) 86, 466
TspGWI ACGGA 1 cut(s) 443
VpaK11BI GGWCC 3 cut(s) 264, 535, 571
XagI CCTNNNNNAGG 1 cut(s) 509
XapI RAATTY 1 cut(s) 158
XceI RCATGY 1 cut(s) 503
XhoI CTCGAG 1 cut(s) 494
XspI CTAG 1 cut(s) 390
ZrmI AGTACT 1 cut(s) 418
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.