RchiOBHm_Chr2g0145991

Aspartokinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
63757127 .. 63758953
1827 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 171 bp
ATGCTCCATGTTCTCTGCTTGGAATTACTTGACCATGTTGTGGAAGAACTGGAGAAAATTGCTGTTGTCAATCTCCTTCAGCACCAATCAATAATATCTCTCATTGGAAATGTGCAAAAATCATCACTAATATTAGAGAAGTTGTTGTACTGTGTTTTGCCAAGTACTTAG

Protein Analysis

56

Amino Acids

6.29

Weight (kDa)

5.36

Isoelectric Point (pI)

40.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000493)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g29820 FvH4_2g29820 FvH4_2g29822 FvH4_2g29824 FvH4_2g29824 FvH4_2g29824 FvH4_2g29840 FvH4_2g29840 FvH4_2g29840 FvH4_5g00550 FvH4_5g00550
malus_domestica MD02G1032700.v1.1 MD08G1140900.v1.1 MD08G1141400.v1.1 MD15G1117800.v1.1 MD15G1117900.v1.1
prunus_persica Prupe.1G471200_v2.0.a1 Prupe.1G471300_v2.0.a1 Prupe.1G471300_v2.0.a1 Prupe.1G471400_v2.0.a1 Prupe.7G242900_v2.0.a1
pyrus_communis pycom02g02690 pycom08g11890
rosa_chinensis RchiOBHm_Chr2g0111741 RchiOBHm_Chr2g0145991 RchiOBHm_Chr6g0298851 RchiOBHm_Chr6g0298871 RchiOBHm_Chr6g0298891 RchiOBHm_Chr6g0298901 RchiOBHm_Chr6g0298911 RchiOBHm_Chr7g0201801 RchiOBHm_Chr7g0211531 RchiOBHm_Chr7g0214601
rosa_laevigata RLG00000002931 RLG00000003000 RLG00000003647 RLG00000011476 RLG00000011479
rosa_multiflora Rmu_sc0001030.1_g000012 Rmu_sc0001548.1_g000041 Rmu_ssc0000397.1_g000033 Rmu_ssc0000397.1_g000036 Rmu_ssc0000397.1_g000037 Rmu_ssc0000397.1_g000039 Rmu_ssc0000397.1_g000048
rosa_roxburghii Rroxscaffold_1G00003830 Rroxscaffold_3G00247810 Rroxscaffold_3G00255060 Rroxscaffold_7G00169220 Rroxscaffold_7G00169230 Rroxscaffold_7G00169280
rosa_rugosa Rorug02G0223600 Rorug06G0283100 Rorug06G0283100 Rorug06G0283100 Rorug06G0283100 Rorug06G0283200 Rorug06G0283300 Rorug06G0283400 Rorug06G0283500 Rorug07G0066000
rosa_samantha Rh2AG511300 Rh2CG235100 Rh2CG496400 Rh2DG330900 Rh6BG403100 Rh6BG403300 Rh6BG403400 Rh6BG403500 Rh6CG408700 Rh6CG408900 Rh6CG409000 Rh6CG409200 Rh6DG395800 Rh6DG395900 Rh6DG396000 Rh6DG396200 Rh7AG193400 Rh7BG195100 Rh7BG436600 Rh7DG199300 Rh7DG265500
rosa_wichuraiana Rw2G016900 Rw6G034570 Rw6G034580 Rw6G034590 Rw6G034600 Rw7G016900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 40
AcuI CTGAAG 1 cut(s) 62
AfaI GTAC 2 cut(s) 149, 166
AfiI CCNNNNNNNGG 1 cut(s) 40
BarI GAAGNNNNNNTAC 2 cut(s) 131, 163
BmcAI AGTACT 1 cut(s) 166
BpmI CTGGAG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 40
BseNI ACTGG 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 40
BsrI ACTGG 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 152
BstDEI CTNAG 1 cut(s) 168
Csp6I GTAC 2 cut(s) 148, 165
CviAII CATG 2 cut(s) 8, 35
CviQI GTAC 2 cut(s) 148, 165
DdeI CTNAG 1 cut(s) 168
Eco57I CTGAAG 1 cut(s) 62
FaeI CATG 2 cut(s) 11, 38
FaiI YATR 2 cut(s) 9, 36
FatI CATG 2 cut(s) 7, 34
FspEI CC 8 cut(s) 5, 20, 26, 35, 47, 89, 90, 98
GsuI CTGGAG 1 cut(s) 71
Hin1II CATG 2 cut(s) 11, 38
HpyAV CCTTC 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 115
HpyF3I CTNAG 1 cut(s) 168
Hsp92II CATG 2 cut(s) 11, 38
LmnI GCTCC 1 cut(s) 9
LpnPI CCDG 1 cut(s) 35
MboII GAAGA 1 cut(s) 56
MluCI AATT 2 cut(s) 23, 57
NlaIII CATG 2 cut(s) 11, 38
PflMI CCANNNNNTGG 1 cut(s) 40
RsaI GTAC 2 cut(s) 149, 166
RsaNI GTAC 2 cut(s) 148, 165
ScaI AGTACT 1 cut(s) 166
SgeI CNNG 5 cut(s) 20, 31, 41, 47, 62
Sse9I AATT 2 cut(s) 23, 57
SspI AATATT 1 cut(s) 132
TaaI ACNGT 1 cut(s) 152
TasI AATT 2 cut(s) 23, 57
TatI WGTACW 2 cut(s) 147, 164
Van91I CCANNNNNTGG 1 cut(s) 40
ZrmI AGTACT 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.