Rmu_co8136160.1_g000001

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8136160.1
OG0000591
Physical Location & Seq
Forward (+)
128 .. 529
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8136160.1_g000001.1.cds

Sequence Viewer

Length: 402 bp
atgaggtctacagagggaacttgtctggggggttttcgtcatacaattctggtcacaagttcaacaaggcatgctgaactactagctttgcttttgggattacagtttggcatctctaatggctttttacctctaataggggagacgaactgtcaagtcctagttcaggcggtgacaaaccaggcccttgatcaaaatgatctgggttttcttatccatgatcttagggagcttctacaggcagtgtcttctgctcaggtttgctatgtgaggcgccaggcaaactcggtggcacataggttagctcaagaagcgaagcagtcttcgttttctctgaatttatttcatttccctcctctgagtgtggaggagattataaacgttgattgtaacgaccattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PfkB TB2_DP1_HVA22

Protein Analysis

133

Amino Acids

14.64

Weight (kDa)

5.79

Isoelectric Point (pI)

40.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000591)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G03566
fragaria_vesca FvH4_2g12622 FvH4_2g12642 FvH4_2g13902 FvH4_3g05011 FvH4_3g18961 FvH4_3g31940 FvH4_4g08421 FvH4_4g21351 FvH4_5g28071 FvH4_5g34871 FvH4_6g21812 FvH4_6g30441 FvH4_6g33631
rosa_chinensis RchiOBHm_Chr1g0320221 RchiOBHm_Chr1g0356521 RchiOBHm_Chr4g0389021 RchiOBHm_Chr5g0020651 RchiOBHm_Chr5g0027511
rosa_laevigata RLG00000002966 RLG00000019504
rosa_multiflora Rmu_co7963640.1_g000001 Rmu_co7988458.1_g000001 Rmu_co8109512.1_g000001 Rmu_co8136160.1_g000001 Rmu_co8253655.1_g000001 Rmu_sc0000388.1_g000040 Rmu_sc0000540.1_g000056 Rmu_sc0000574.1_g000013 Rmu_sc0000623.1_g000001 Rmu_sc0000795.1_g000005 Rmu_sc0000795.1_g000006 Rmu_sc0001063.1_g000001 Rmu_sc0002116.1_g000001 Rmu_sc0002192.1_g000012 Rmu_sc0002640.1_g000015 Rmu_sc0003337.1_g000039 Rmu_sc0004298.1_g000003 Rmu_sc0004771.1_g000001 Rmu_sc0006119.1_g000010 Rmu_sc0006633.1_g000007 Rmu_sc0007025.1_g000016 Rmu_sc0007221.1_g000002 Rmu_sc0007222.1_g000002 Rmu_sc0007806.1_g000016 Rmu_sc0008241.1_g000018 Rmu_sc0008348.1_g000001 Rmu_sc0009034.1_g000001 Rmu_sc0009955.1_g000004 Rmu_sc0018325.1_g000009 Rmu_sc0028328.1_g000002 Rmu_sc0030178.1_g000001 Rmu_sc0034381.1_g000001 Rmu_sc0041085.1_g000001 Rmu_sc0041085.1_g000002
rosa_roxburghii Rroxscaffold_3G00233230 Rroxscaffold_7G00193120 Rroxscaffold_7G00194820
rosa_rugosa Rorug01G0017000 Rorug01G0036400 Rorug01G0062600 Rorug01G0118500 Rorug02G0351500 Rorug02G0497600 Rorug03G0233200 Rorug03G0279500 Rorug03G0347600 Rorug04G0077100 Rorug04G0077200 Rorug04G0210900 Rorug05G0206900 Rorug07G0202900 Rorug07G0334000
rosa_samantha Rh2CG195700 Rh4DG035800
rosa_wichuraiana Rw0G005080 Rw0G013600 Rw2G020080 Rw2G024380 Rw5G002230 Rw5G036790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 377
AccB1I GGYRCC 1 cut(s) 273
AccI GTMKAC 1 cut(s) 8
AciI CCGC 1 cut(s) 170
AclI AACGTT 1 cut(s) 381
AcsI RAATTY 1 cut(s) 337
AcyI GRCGYC 1 cut(s) 274
AfiI CCNNNNNNNGG 2 cut(s) 137, 166
AgsI TTSAA 1 cut(s) 63
AhdI GACNNNNNGTC 1 cut(s) 150
AjnI CCWGG 2 cut(s) 180, 276
AluBI AGCT 3 cut(s) 86, 232, 305
AluI AGCT 3 cut(s) 86, 232, 305
Alw26I GTCTC 1 cut(s) 137
AoxI GGCC 1 cut(s) 183
ApoI RAATTY 1 cut(s) 337
AspLEI GCGC 1 cut(s) 276
AspS9I GGNCC 1 cut(s) 184
AsuHPI GGTGA 1 cut(s) 184
BanI GGYRCC 1 cut(s) 273
BbsI GAAGAC 2 cut(s) 240, 315
BciT130I CCWGG 2 cut(s) 182, 278
BclI TGATCA 1 cut(s) 190
BcoDI GTCTC 1 cut(s) 137
BfaI CTAG 2 cut(s) 83, 161
BfmI CTRYAG 2 cut(s) 9, 236
BfoI RGCGCY 1 cut(s) 277
Bme1390I CCNGG 2 cut(s) 182, 278
BmeRI GACNNNNNGTC 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 184
BmiI GGNNCC 1 cut(s) 275
BmrFI CCNGG 2 cut(s) 182, 278
BmsI GCATC 1 cut(s) 120
BpiI GAAGAC 2 cut(s) 240, 315
Bpu10I CCTNAGC 1 cut(s) 255
BpuEI CTTGAG 1 cut(s) 291
BsaHI GRCGYC 1 cut(s) 274
Bsc4I CCNNNNNNNGG 2 cut(s) 137, 166
BseBI CCWGG 2 cut(s) 182, 278
BseLI CCNNNNNNNGG 2 cut(s) 137, 166
BseMII CTCAG 2 cut(s) 269, 350
BseRI GAGGAG 2 cut(s) 345, 383
BshFI GGCC 1 cut(s) 185
BshNI GGYRCC 1 cut(s) 273
BslI CCNNNNNNNGG 2 cut(s) 137, 166
BsmAI GTCTC 1 cut(s) 137
BsmBI CGTCTC 1 cut(s) 137
BsnI GGCC 1 cut(s) 185
Bsp143I GATC 3 cut(s) 190, 199, 220
BspACI CCGC 1 cut(s) 170
BspANI GGCC 1 cut(s) 185
BspCNI CTCAG 2 cut(s) 268, 351
BspLI GGNNCC 1 cut(s) 275
BspT107I GGYRCC 1 cut(s) 273
BssMI GATC 3 cut(s) 190, 199, 220
BssNI GRCGYC 1 cut(s) 274
Bst2UI CCWGG 2 cut(s) 182, 278
Bst4CI ACNGT 2 cut(s) 105, 152
BstACI GRCGYC 1 cut(s) 274
BstC8I GCNNGC 1 cut(s) 72
BstDEI CTNAG 3 cut(s) 224, 255, 359
BstENI CCTNNNNNAGG 2 cut(s) 135, 164
BstH2I RGCGCY 1 cut(s) 277
BstHHI GCGC 1 cut(s) 276
BstKTI GATC 3 cut(s) 193, 202, 223
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 3 cut(s) 190, 199, 220
BstMWI GCNNNNNNNGC 1 cut(s) 311
BstNI CCWGG 2 cut(s) 182, 278
BstNSI RCATGY 1 cut(s) 74
BstSCI CCNGG 2 cut(s) 180, 276
BstSFI CTRYAG 2 cut(s) 9, 236
BstV2I GAAGAC 2 cut(s) 240, 315
BsuRI GGCC 1 cut(s) 185
BtsI GCAGTG 1 cut(s) 249
BtsIMutI CAGTG 1 cut(s) 249
Cac8I GCNNGC 1 cut(s) 72
CfoI GCGC 1 cut(s) 276
Cfr13I GGNCC 1 cut(s) 184
CspCI CAANNNNNGTGG 2 cut(s) 270, 305
CviAII CATG 2 cut(s) 71, 218
CviJI RGCY 5 cut(s) 86, 123, 185, 232, 305
CviKI_1 RGCY 5 cut(s) 86, 123, 185, 232, 305
DdeI CTNAG 3 cut(s) 224, 255, 359
DinI GGCGCC 1 cut(s) 275
DpnI GATC 3 cut(s) 192, 201, 222
DpnII GATC 3 cut(s) 190, 199, 220
DriI GACNNNNNGTC 1 cut(s) 150
Eam1105I GACNNNNNGTC 1 cut(s) 150
EcoNI CCTNNNNNAGG 2 cut(s) 135, 164
EcoO109I RGGNCCY 1 cut(s) 184
EcoRII CCWGG 2 cut(s) 180, 276
EgeI GGCGCC 1 cut(s) 275
EheI GGCGCC 1 cut(s) 275
Esp3I CGTCTC 1 cut(s) 137
FaeI CATG 2 cut(s) 74, 221
FaiI YATR 6 cut(s) 42, 72, 219, 267, 297, 377
FatI CATG 2 cut(s) 70, 217
FbaI TGATCA 1 cut(s) 190
FblI GTMKAC 1 cut(s) 8
FspBI CTAG 2 cut(s) 83, 161
GlaI GCGC 1 cut(s) 275
HaeII RGCGCY 1 cut(s) 277
HaeIII GGCC 1 cut(s) 185
HhaI GCGC 1 cut(s) 276
Hin1I GRCGYC 1 cut(s) 274
Hin1II CATG 2 cut(s) 74, 221
Hin6I GCGC 1 cut(s) 274
HinP1I GCGC 1 cut(s) 274
HphI GGTGA 1 cut(s) 184
Hpy166II GTNNAC 1 cut(s) 9
Hpy188I TCNGA 2 cut(s) 336, 360
Hpy188III TCNNGA 1 cut(s) 308
Hpy8I GTNNAC 1 cut(s) 9
HpyCH4III ACNGT 2 cut(s) 105, 152
HpyCH4IV ACGT 1 cut(s) 381
HpyF10VI GCNNNNNNNGC 1 cut(s) 311
HpyF3I CTNAG 3 cut(s) 224, 255, 359
HpySE526I ACGT 1 cut(s) 381
Hsp92I GRCGYC 1 cut(s) 274
Hsp92II CATG 2 cut(s) 74, 221
HspAI GCGC 1 cut(s) 274
KasI GGCGCC 1 cut(s) 273
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 3 cut(s) 190, 199, 220
LmnI GCTCC 1 cut(s) 229
LweI GCATC 1 cut(s) 120
MaeI CTAG 2 cut(s) 83, 161
MaeII ACGT 1 cut(s) 381
MaeIII GTNAC 3 cut(s) 52, 172, 389
MalI GATC 3 cut(s) 192, 201, 222
MboI GATC 3 cut(s) 190, 199, 220
MboII GAAGA 2 cut(s) 240, 315
MluCI AATT 2 cut(s) 45, 337
Mly113I GGCGCC 1 cut(s) 274
MnlI CCTC 6 cut(s) 7, 141, 264, 361, 363, 366
MseI TTAA 1 cut(s) 400
MspR9I CCNGG 2 cut(s) 182, 278
MvaI CCWGG 2 cut(s) 182, 278
MwoI GCNNNNNNNGC 1 cut(s) 311
NarI GGCGCC 1 cut(s) 274
NdeII GATC 3 cut(s) 190, 199, 220
NlaIII CATG 2 cut(s) 74, 221
NlaIV GGNNCC 1 cut(s) 275
NmuCI GTSAC 2 cut(s) 52, 172
NspI RCATGY 1 cut(s) 74
PaeI GCATGC 1 cut(s) 74
PluTI GGCGCC 1 cut(s) 277
PsiI TTATAA 1 cut(s) 377
Psp1406I AACGTT 1 cut(s) 381
Psp6I CCWGG 2 cut(s) 180, 276
PspGI CCWGG 2 cut(s) 180, 276
PspN4I GGNNCC 1 cut(s) 275
PspPI GGNCC 1 cut(s) 184
SaqAI TTAA 1 cut(s) 400
Sau3AI GATC 3 cut(s) 190, 199, 220
Sau96I GGNCC 1 cut(s) 184
ScrFI CCNGG 2 cut(s) 182, 278
SetI ASST 8 cut(s) 8, 88, 133, 234, 261, 302, 307, 384
SfaNI GCATC 1 cut(s) 120
SfcI CTRYAG 2 cut(s) 9, 236
SfoI GGCGCC 1 cut(s) 275
SmlI CTYRAG 1 cut(s) 306
SmoI CTYRAG 1 cut(s) 306
SphI GCATGC 1 cut(s) 74
Sse9I AATT 2 cut(s) 45, 337
SsiI CCGC 1 cut(s) 170
SspDI GGCGCC 1 cut(s) 273
SspMI CTAG 2 cut(s) 83, 161
StyD4I CCNGG 2 cut(s) 180, 276
TaaI ACNGT 2 cut(s) 105, 152
TaiI ACGT 1 cut(s) 384
TasI AATT 2 cut(s) 45, 337
Tru1I TTAA 1 cut(s) 400
Tru9I TTAA 1 cut(s) 400
TscAI CASTG 1 cut(s) 249
TseFI GTSAC 2 cut(s) 52, 172
Tsp45I GTSAC 2 cut(s) 52, 172
TspDTI ATGAA 1 cut(s) 335
TspRI CASTG 1 cut(s) 249
XagI CCTNNNNNAGG 2 cut(s) 135, 164
XapI RAATTY 1 cut(s) 337
XceI RCATGY 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 8
XspI CTAG 2 cut(s) 83, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.