Rmu_sc0001827.1_g000005

AKAP7 2'5' RNA ligase-like domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001827.1
Physical Location & Seq
Forward (+)
21323 .. 21646
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001827.1_g000005.1.cds

Sequence Viewer

Length: 324 bp
atgattagttaccacccaggtttctttctgattgttacatgtggattttcagaatgctcagtagtggagattacagataagctggaagaagaagtgcactcttgctcatctaccaagatttcaagtgctcaagatgacatagagatggcttcagcagttactgaagcaactaagttcacgacttgttcaagtgcatcgcaagataatgaagaagatgaagttttaggaggagaagcagtgcttttaaccgaaaagcattcagtttcagttgaggcatggtttcattgtcaaatattcactttgtcaggccaatttgtcatatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.68

Weight (kDa)

4.25

Isoelectric Point (pI)

46.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 135, 183
AflIII ACRYGT 1 cut(s) 38
AgsI TTSAA 2 cut(s) 123, 189
AjnI CCWGG 1 cut(s) 16
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
Alw21I GWGCWC 2 cut(s) 99, 130
Alw44I GTGCAC 1 cut(s) 95
AlwNI CAGNNNCTG 1 cut(s) 161
AoxI GGCC 1 cut(s) 307
ApaLI GTGCAC 1 cut(s) 95
BaeGI GKGCMC 1 cut(s) 99
Bbv12I GWGCWC 2 cut(s) 99, 130
BccI CCATC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 18
BmsI GCATC 1 cut(s) 203
BpuEI CTTGAG 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 16
BsaXI ACNNNNNCTCC 2 cut(s) 222, 252
BseBI CCWGG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 16
BseMII CTCAG 1 cut(s) 72
BseRI GAGGAG 1 cut(s) 243
BseSI GKGCMC 1 cut(s) 99
BshFI GGCC 1 cut(s) 309
BsiHKAI GWGCWC 2 cut(s) 99, 130
BsmI GAATGC 2 cut(s) 59, 256
BsnI GGCC 1 cut(s) 309
Bsp1286I GDGCHC 2 cut(s) 99, 130
BspANI GGCC 1 cut(s) 309
BspCNI CTCAG 1 cut(s) 71
BssECI CCNNGG 1 cut(s) 16
Bst2UI CCWGG 1 cut(s) 18
BstDEI CTNAG 2 cut(s) 58, 171
BstNI CCWGG 1 cut(s) 18
BstNSI RCATGY 1 cut(s) 42
BstSCI CCNGG 1 cut(s) 16
BstSLI GKGCMC 1 cut(s) 99
BsuRI GGCC 1 cut(s) 309
BtgZI GCGATG 1 cut(s) 180
BtsI GCAGTG 1 cut(s) 243
BtsIMutI CAGTG 1 cut(s) 243
CaiI CAGNNNCTG 1 cut(s) 161
CviAII CATG 2 cut(s) 39, 276
CviJI RGCY 3 cut(s) 82, 149, 309
CviKI_1 RGCY 3 cut(s) 82, 149, 309
DdeI CTNAG 2 cut(s) 58, 171
Eco57I CTGAAG 2 cut(s) 135, 183
EcoRII CCWGG 1 cut(s) 16
FaeI CATG 2 cut(s) 42, 279
FaiI YATR 5 cut(s) 40, 140, 277, 320, 322
FalI AAGNNNNNCTT 2 cut(s) 225, 257
FatI CATG 2 cut(s) 38, 275
HaeIII GGCC 1 cut(s) 309
Hin1II CATG 2 cut(s) 42, 279
Hpy166II GTNNAC 2 cut(s) 97, 177
Hpy188I TCNGA 2 cut(s) 30, 52
Hpy188III TCNNGA 2 cut(s) 131, 178
Hpy8I GTNNAC 2 cut(s) 97, 177
HpyCH4V TGCA 2 cut(s) 97, 194
HpyF3I CTNAG 2 cut(s) 58, 171
Hsp92II CATG 2 cut(s) 42, 279
LpnPI CCDG 4 cut(s) 3, 30, 68, 291
LweI GCATC 1 cut(s) 203
MaeIII GTNAC 3 cut(s) 8, 34, 157
MboII GAAGA 4 cut(s) 98, 101, 221, 224
MhlI GDGCHC 2 cut(s) 99, 130
MluCI AATT 1 cut(s) 311
MnlI CCTC 2 cut(s) 221, 265
MseI TTAA 1 cut(s) 245
MslI CAYNNNNRTG 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 18
Mva1269I GAATGC 2 cut(s) 59, 256
MvaI CCWGG 1 cut(s) 18
NlaIII CATG 2 cut(s) 42, 279
NspI RCATGY 1 cut(s) 42
PciI ACATGT 1 cut(s) 38
PctI GAATGC 2 cut(s) 59, 256
PscI ACATGT 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PstNI CAGNNNCTG 1 cut(s) 161
RseI CAYNNNNRTG 1 cut(s) 143
SaqAI TTAA 1 cut(s) 245
ScrFI CCNGG 1 cut(s) 18
SduI GDGCHC 2 cut(s) 99, 130
SetI ASST 2 cut(s) 22, 84
SfaNI GCATC 1 cut(s) 203
SmiMI CAYNNNNRTG 1 cut(s) 143
SmlI CTYRAG 1 cut(s) 129
SmoI CTYRAG 1 cut(s) 129
Sse9I AATT 1 cut(s) 311
SspI AATATT 1 cut(s) 294
StyD4I CCNGG 1 cut(s) 16
TasI AATT 1 cut(s) 311
Tru1I TTAA 1 cut(s) 245
Tru9I TTAA 1 cut(s) 245
TscAI CASTG 1 cut(s) 243
TspDTI ATGAA 3 cut(s) 222, 231, 272
TspRI CASTG 1 cut(s) 243
VneI GTGCAC 1 cut(s) 95
XceI RCATGY 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.