Rh6DG369800

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
56553279 .. 56563567
10289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG369800.1

Sequence Viewer

Length: 270 bp
ATGAGTGCAGGGGTAATTCTTTACATCCTTCTTAGTGGAATACCACCATTTTGGGGGAAGATAAAGTCAAGCATATTTGATGCTGTTAGGACAGCTGATCTGAGGTTCCCATCTGATCCTTGGGATGGCATCACTGAATTAGCTAATGATTTGATTCGAGGAATGCTTTGTAAAGATCCTTCTAAAAGGCTCACCGCTCACCAGGTTTTAGGTGGTTCAAGTAATGATTTCAGTAACAGAGTATGCTCAAATGCTGATCTCAGATGCTAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.74

Weight (kDa)

7.73

Isoelectric Point (pI)

35.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 2 - 70 1.8e-10 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 197
AciI CCGC 1 cut(s) 195
AclWI GGATC 2 cut(s) 110, 170
AfiI CCNNNNNNNGG 2 cut(s) 53, 125
AgsI TTSAA 1 cut(s) 219
AjnI CCWGG 1 cut(s) 201
AluBI AGCT 2 cut(s) 95, 143
AluI AGCT 2 cut(s) 95, 143
AlwI GGATC 2 cut(s) 110, 170
AsuHPI GGTGA 2 cut(s) 184, 191
BarI GAAGNNNNNNTAC 2 cut(s) 163, 195
BccI CCATC 2 cut(s) 118, 119
BciT130I CCWGG 1 cut(s) 203
Bme1390I CCNGG 1 cut(s) 203
BmiI GGNNCC 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 203
BmsI GCATC 3 cut(s) 70, 138, 254
BsaJI CCNNGG 1 cut(s) 119
Bsc4I CCNNNNNNNGG 2 cut(s) 53, 125
BseBI CCWGG 1 cut(s) 203
BseDI CCNNGG 1 cut(s) 119
BseGI GGATG 2 cut(s) 24, 130
BseLI CCNNNNNNNGG 2 cut(s) 53, 125
BseMII CTCAG 1 cut(s) 92
BsgI GTGCAG 1 cut(s) 27
BslI CCNNNNNNNGG 2 cut(s) 53, 125
BsmI GAATGC 1 cut(s) 168
Bsp143I GATC 4 cut(s) 97, 115, 175, 256
BspACI CCGC 1 cut(s) 195
BspCNI CTCAG 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 107
BspPI GGATC 2 cut(s) 110, 170
BsrBI CCGCTC 1 cut(s) 197
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 4 cut(s) 97, 115, 175, 256
BssT1I CCWWGG 1 cut(s) 119
Bst2UI CCWGG 1 cut(s) 203
BstDEI CTNAG 3 cut(s) 32, 101, 260
BstF5I GGATG 2 cut(s) 24, 130
BstKTI GATC 4 cut(s) 100, 118, 178, 259
BstMBI GATC 4 cut(s) 97, 115, 175, 256
BstNI CCWGG 1 cut(s) 203
BstSCI CCNGG 1 cut(s) 201
BstX2I RGATCY 1 cut(s) 175
BstXI CCANNNNNNTGG 1 cut(s) 51
BstYI RGATCY 1 cut(s) 175
BtsCI GGATG 2 cut(s) 24, 130
BtsIMutI CAGTG 1 cut(s) 132
CsiI ACCWGGT 1 cut(s) 201
CviJI RGCY 3 cut(s) 95, 143, 190
CviKI_1 RGCY 3 cut(s) 95, 143, 190
DdeI CTNAG 3 cut(s) 32, 101, 260
DpnI GATC 4 cut(s) 99, 117, 177, 258
DpnII GATC 4 cut(s) 97, 115, 175, 256
Eco130I CCWWGG 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 201
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaiI YATR 2 cut(s) 74, 244
FokI GGATG 2 cut(s) 11, 137
HinfI GANTC 1 cut(s) 154
HphI GGTGA 2 cut(s) 184, 191
Hpy188I TCNGA 3 cut(s) 102, 115, 263
HpyAV CCTTC 2 cut(s) 38, 189
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 3 cut(s) 32, 101, 260
Kzo9I GATC 4 cut(s) 97, 115, 175, 256
LpnPI CCDG 2 cut(s) 188, 215
LweI GCATC 3 cut(s) 70, 138, 254
MabI ACCWGGT 1 cut(s) 201
MaeIII GTNAC 1 cut(s) 233
MalI GATC 4 cut(s) 99, 117, 177, 258
MbiI CCGCTC 1 cut(s) 197
MboI GATC 4 cut(s) 97, 115, 175, 256
MboII GAAGA 1 cut(s) 70
MflI RGATCY 1 cut(s) 175
MluCI AATT 2 cut(s) 15, 137
MnlI CCTC 2 cut(s) 96, 152
MspA1I CMGCKG 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 203
Mva1269I GAATGC 1 cut(s) 168
MvaI CCWGG 1 cut(s) 203
NdeII GATC 4 cut(s) 97, 115, 175, 256
NlaIV GGNNCC 1 cut(s) 107
PctI GAATGC 1 cut(s) 168
PfeI GAWTC 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 201
PspGI CCWGG 1 cut(s) 201
PspN4I GGNNCC 1 cut(s) 107
PsuI RGATCY 1 cut(s) 175
PvuII CAGCTG 1 cut(s) 95
Sau3AI GATC 4 cut(s) 97, 115, 175, 256
ScrFI CCNGG 1 cut(s) 203
SetI ASST 5 cut(s) 97, 107, 145, 207, 214
SexAI ACCWGGT 1 cut(s) 201
SfaNI GCATC 3 cut(s) 70, 138, 254
SgeI CNNG 7 cut(s) 21, 81, 132, 170, 214, 215, 231
Sse9I AATT 2 cut(s) 15, 137
SsiI CCGC 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 201
StyI CCWWGG 1 cut(s) 119
TaqI TCGA 1 cut(s) 157
TasI AATT 2 cut(s) 15, 137
TfiI GAWTC 1 cut(s) 154
TscAI CASTG 1 cut(s) 139
TspRI CASTG 1 cut(s) 139
XcmI CCANNNNNNNNNTGG 2 cut(s) 117, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.